North Eastern Indira Gandhi Regional Institute Of Health And Medical Sciences Tender

View complete overview of Meghalaya NEIGRIHMS Tender

North Eastern Indira Gandhi Regional Institute Of Health And Medical Sciences - NEIGRIHMS Tender

Goods
Healthcare and Medicine
GEM
Opening Date25 Jun 2024
Closing Date18 Jul 2024
Tender Amount₹ 3,59,100 
Notes
Download

Description

Unlock the Tender details for free
Scription for unregistered user this is tender description for unregistered user this is tender description for unregistered user this is tender description for unregistered user this is tender description for unregistered user this is tender description for unregistered user this is tender description for unregistered user this is tender description for unregistered user this is tender description for unregistered user this is tender description for unregistered user this is tender description for unregistered user this is tender description for unregistered user this is tender description for unregistered user this is tender description for unregistered user this is tender description for unregistered user this is tender description for unregistered user this is tender description for unregistered user this is tender description for unregistered user

Contact

Unlock the Tender details for free
GEM & Bid Advisory Services
Get portal registration, tender bidding, product/service listing or vendor/MSME certification services at a nominal cost

BOQ Items

... More
DO_NOT_SHOW

-

-

-

View all details for FREE
... More
Pasteur pipette sterile 5ml sterile individually packed. 50pc , Pasteur pipette sterile 5ml sterile individually packed. 50pc

2

-

-

... More
0.2 mL PCR Tube Flat Cap PP Flat Cap. 1000 pc , 0.2 mL PCR Tube Flat Cap PP Flat Cap. 1000 pc

1

-

-

... More
10mL Syringe with Needle Sterile Single Use. 50mL , 10mL Syringe with Needle Sterile Single Use. 50mL

2

-

-

... More
2mL Syringe with Needle sterile Single Use. 100 mL , 2mL Syringe with Needle sterile Single Use. 100 mL

2

-

-

... More
Sterile sample container 50ml sterile PP HDPE. 384pc , Sterile sample container 50ml sterile PP HDPE. 384pc

2

-

-

... More
Sterile sample bags 4 inches x 6 inches LDPE. 100pc , Sterile sample bags 4 inches x 6 inches LDPE. 100pc

2

-

-

... More
Sterile swab stick Sterile Cotton Swabs in screw capped Polypropylene tube. 100pc , Sterile swab stick Sterile Cotton Swabs in screw capped Polypropylene tube. 100pc

2

-

-

... More
1.8 mL Cryochill vials Self standing PP HDPE sterile 1.8 ml External thread. 1000pc , 1.8 mL Cryochill vials Self standing PP HDPE sterile 1.8 ml External thread. 1000pc

1

-

-

... More
Test tube stand PC 31 places 13mm tube diameter. 4pc , Test tube stand PC 31 places 13mm tube diameter. 4pc

2

-

-

... More
Steam indicator tape Size 1 inches x 100 inches.Roll , Steam indicator tape Size 1 inches x 100 inches.Roll

4

-

-

... More
Soft loop sterile 10 microlitre.Material PS 10 microlitre pouch of 10. 100pc , Soft loop sterile 10 microlitre.Material PS 10 microlitre pouch of 10. 100pc

2

-

-

... More
Surgical mask 3 Ply layer with nose pin and elastic earloops.100 , Surgical mask 3 Ply layer with nose pin and elastic earloops.100

25

-

-

... More
Nitrile gloves 9.5 inches length Size Medium Mid forearm Powder Free. 100pc , Nitrile gloves 9.5 inches length Size Medium Mid forearm Powder Free. 100pc

5

-

-

... More
MacConkey Agar Powder 500gm , MacConkey Agar Powder 500gm

500

-

-

... More
Blood Agar Base Infusion Agar Powder 500gm , Blood Agar Base Infusion Agar Powder 500gm

500

-

-

... More
Mueller Hinton Agar Powder 500gm , Mueller Hinton Agar Powder 500gm

500

-

-

... More
Soyabean Casein Digest Medium Tryptone Soya Broth Powder 500gm , Soyabean Casein Digest Medium Tryptone Soya Broth Powder 500gm

500

-

-

... More
Decarboxylase Broth Base Moeller Moeller Decarboxylase Broth Base Powder 500gm , Decarboxylase Broth Base Moeller Moeller Decarboxylase Broth Base Powder 500gm

500

-

-

... More
L Lysine monohydrochloride Powder 100gm , L Lysine monohydrochloride Powder 100gm

100

-

-

... More
L Arginine monohydrochloride Powder 100gm , L Arginine monohydrochloride Powder 100gm

100

-

-

... More
L Ornithine monohydrochloride Powder 100gm , L Ornithine monohydrochloride Powder 100gm

100

-

-

... More
OF Basal Media Powder 500gm , OF Basal Media Powder 500gm

500

-

-

... More
Liquid media with swab stick HiCulture Transport swabs with Amies Medium B. For Collection and transport of aerobic anaerobic and fastidious organisms 50 pc , Liquid media with swab stick HiCulture Transport swabs with Amies Medium B. For Collection and transport of aerobic anaerobic and fastidious organisms 50 pc

1

-

-

... More
Tris buffer. Powder for molrcular biology 100 g , Tris buffer. Powder for molrcular biology 100 g

100

-

-

... More
Boric acid. Powder for molecular biology 500g , Boric acid. Powder for molecular biology 500g

500

-

-

... More
EDTA. Powder for molecular biology 100g , EDTA. Powder for molecular biology 100g

100

-

-

... More
TAQ DNA Polymerase. 5U mcL PCR reagent 500U , TAQ DNA Polymerase. 5U mcL PCR reagent 500U

1

-

-

... More
dNTP Mix 10mM each. PCR reagent 10mM each 1 mL , dNTP Mix 10mM each. PCR reagent 10mM each 1 mL

1

-

-

... More
Magnesium Chloride 25mM. PCR reagent 25mM 4x1.25mL , Magnesium Chloride 25mM. PCR reagent 25mM 4x1.25mL

1

-

-

... More
Alcohol Chinese. Liquid 500mL , Alcohol Chinese. Liquid 500mL

30

-

-

... More
Spirit. Liquid 450mL , Spirit. Liquid 450mL

20

-

-

... More
Sanitizer. Liquid 500mL , Sanitizer. Liquid 500mL

10

-

-

... More
Distilled water. Liquid 5 litres , Distilled water. Liquid 5 litres

5

-

-

... More
Cotton 500g , Cotton 500g

15

-

-

... More
Gentamicin sulphate. Gentamycin sulphate Plant Culture Tested Potency greater or equal to 590 ug mg Store at 2 to 8degree C. 1 gram , Gentamicin sulphate. Gentamycin sulphate Plant Culture Tested Potency greater or equal to 590 ug mg Store at 2 to 8degree C. 1 gram

1

-

-

... More
Colistin sulphate. Colistin Sulphate Plant Culture Tested Potency greater 19.000 units mg store at 2 to 8 degree C.1gram , Colistin sulphate. Colistin Sulphate Plant Culture Tested Potency greater 19.000 units mg store at 2 to 8 degree C.1gram

1

-

-

... More
QIAamp DNA isolation Mini Kit 50. With spin column collection tube reagents and buffers. For isolation of genomic mitochondrial bacterial parasite or viral DNA 50reaction , QIAamp DNA isolation Mini Kit 50. With spin column collection tube reagents and buffers. For isolation of genomic mitochondrial bacterial parasite or viral DNA 50reaction

1

-

-

... More
PlatinumTM Hot Start PCR Master Mix 2X. For Molecular Biology 50 reaction. , PlatinumTM Hot Start PCR Master Mix 2X. For Molecular Biology 50 reaction.

1

-

-

... More
SYBRTM Green PCR Master Mix. For Real Time PCR 1mL , SYBRTM Green PCR Master Mix. For Real Time PCR 1mL

1

-

-

... More
Agarose special, Low EEO. For Molecular Biology 100gm , Agarose special, Low EEO. For Molecular Biology 100gm

1

-

-

... More
Ethidium bromide 10mg mL.For Molecular Biology. 10mL , Ethidium bromide 10mg mL.For Molecular Biology. 10mL

1

-

-

... More
100bp DNA Ladder 50mcg , 100bp DNA Ladder 50mcg

1

-

-

... More
Water Sterile Molecular Biology Grade. DEPC treated Nuclease and Protease free. 500ml , Water Sterile Molecular Biology Grade. DEPC treated Nuclease and Protease free. 500ml

1

-

-

... More
50X TBE electrophoresis buffer. For Molecular Biology 500mL , 50X TBE electrophoresis buffer. For Molecular Biology 500mL

1

-

-

... More
TTS1F 5 5CTTCAATCTGCTCTTTCCGTT3 Primer Length 21bp Scale 50nanomole Desalted 50nanomole , TTS1F 5 5CTTCAATCTGCTCTTTCCGTT3 Primer Length 21bp Scale 50nanomole Desalted 50nanomole

1

-

-

... More
TTS1R 5CAGGACGGTTTCGGACGAA3 Primer Length 19bp Scale 50nanomole Desalted 50nanomole , TTS1R 5CAGGACGGTTTCGGACGAA3 Primer Length 19bp Scale 50nanomole Desalted 50nanomole

1

-

-

... More
SBPF 5AGCTCGCAGATGAACTGGAT3 Primer Length 20bp Scale 50nanomole Desalted 50nanomole , SBPF 5AGCTCGCAGATGAACTGGAT3 Primer Length 20bp Scale 50nanomole Desalted 50nanomole

1

-

-

... More
SBPR 5GCTGATCGTTGTTCGTCGTA3 Primer Length 20bp Scale 50nanomole Desalted 50nanomole , SBPR 5GCTGATCGTTGTTCGTCGTA3 Primer Length 20bp Scale 50nanomole Desalted 50nanomole

1

-

-

... More
HP-F 5CCCAATCAGACCGACGTATT3 Primer Length 20bp Scale 50nanomole Desalted 50nanomole , HP-F 5CCCAATCAGACCGACGTATT3 Primer Length 20bp Scale 50nanomole Desalted 50nanomole

1

-

-

... More
HPR 5GTTCAACGCGCCTTTATTGT Primer Length 20bp Scale 50nanomole Desalted 50nanomole , HPR 5GTTCAACGCGCCTTTATTGT Primer Length 20bp Scale 50nanomole Desalted 50nanomole

1

-

-

... More
OMP F 5TCTGGTTCATGCTGGTTTCA3 Primer Length 20bp Scale 50nanomole Desalted 50nanomole , OMP F 5TCTGGTTCATGCTGGTTTCA3 Primer Length 20bp Scale 50nanomole Desalted 50nanomole

1

-

-

... More
OMP R 5GGCCGTAATACCAGTTGCTC3 Primer Length 20bp Scale 50nanomole Desalted 50nanomole , OMP R 5GGCCGTAATACCAGTTGCTC3 Primer Length 20bp Scale 50nanomole Desalted 50nanomole

1

-

-

... More
16s F 5TCCTTGGCTCTAATACAGTCGG3 Primer Length 22bp Scale 50nanomole Desalted 50nanomole , 16s F 5TCCTTGGCTCTAATACAGTCGG3 Primer Length 22bp Scale 50nanomole Desalted 50nanomole

1

-

-

... More
16s R 5TCAGCAGGATTCCGACCAT3 Primer Length 19bp Scale 50nanomole Desalted 50nanomole , 16s R 5TCAGCAGGATTCCGACCAT3 Primer Length 19bp Scale 50nanomole Desalted 50nanomole

1

-

-

... More
Liquid hand wash 200mL , Liquid hand wash 200mL

20

-

-

... More
Tissue roll , Tissue roll

50

-

-

... More
A4 size paper , A4 size paper

10

-

-

... More
Pen Blue Black Red , Pen Blue Black Red

30

-

-

... More
Cellotape Brown 48mm , Cellotape Brown 48mm

10

-

-

... More
Cellotape Transparent 48mm , Cellotape Transparent 48mm

10

-

-



Evaluation Notes How It Works ?

Potential Partner

Select Your Requirements
Disclaimer: BidAssist has made every reasonable effort to ensure that the information is accurate and authentic however it cannot be held liable for any third-party claims or losses of any damages. BidAssist makes no warranty, expressed or implied, as to the results obtained from the use of the information. If you think you may have noticed any error or omission, please let us know by contacting contact@bidassist.com.