Research Institute For Tropical Medicine, Doh Tender

Description Request For Quotation Mode Of Procurement: Small Value Procurement Date: _____________ Pr No.: _____________ Rfq No.: _____________ Company/business Name: Complete Office Address: Business/mayor’s Permit No: Tin: The Research Institute For Tropical Medicine – Department Of Health, Through Its Bids And Awards Committee (bac), Intends To Procure The Below Mentioned Items Through The Above-mentioned Mode Of Procurement Based On The 2016 Revised Implementing Rules And Regulations Of Republic Act No. 9184. Please Quote Your Best Offer For The Item/s Described Herein, Subject To The Terms And Conditions Provided On This Request For Quotation (rfq). Submit Your Quotation Duly Signed By You, Or Your Duly Authorized Representative Within Five (5) Days Which Shall Be Addressed To The Ritm Bids And Awards Committee. A)the Following Documents Are Required To Be Submitted Along With Your Formal Quotation: Documentary Requirement Remarks Valid And Current Mayor’s/business Permit In Case Not Yet Available, You May Submit Your Expired Mayor’s Or Business Permit With The Official Receipt Of Renewal Application. However, A Copy Of The Latest Mayor’s Or Business Permit Shall Be Required To Be Submitted After Award Of Contract But Before Payment. Valid And Current Certificate Of Platinum Membership With Valid Annex “a” May Be Submitted In Lieu Of The Mayor’s/business Permit Philgeps Registration/membership Bir Form 2303 Company Name Registered In Sec/dti/cda Must Be The Same Registered Name In Bir Form 2303. B)the Following Documents Shall Be Submitted By The Bidder Before The Issuance Of Notice Of Award: Documentary Requirement Remarks Duly Notarized Revised Omnibus Sworn Statement (10 Provisions) With Latest Rules On Notarial Practice Applicable For: Np-svp With Abcs Above P50,000.00 And Np-ec With Abcs Above P500,000.00 Note: Othe Pr # Shall Be Reflected In The Omnibus Sworn Statement Oone (1) Original Copy Must Be Submitted Othe Issuance And Notarial Date Of The Omnibus Sworn Statement Shall Be The Same/after The Issuance And Notarial Date Of The Authority Of The Signatory. Othe Authorized Representative Declared In The Omnibus Sworn Statement Shall Be In Congruent With The Submitted Authority Of The Signatory. Authority Of The Signatory Applicable For: Np-svp With Abcs Above P50,000.00 And Np-ec With Abcs Above P500,000.00 for Sole Proprietorship – Duly Notarized Special Power Of Attorney, If Signatory Is Other Than The Owner for Corporation – Duly Notarized Secretary’s Certificate for Partnership, Cooperative, Or Joint Venture – Duly Notarized Board/partnership Resolution, Whichever Is Applicable Note: Othe Pr # Shall Be Reflected In The Authority Of The Signatory Oone (1) Original Copy Must Be Submitted Othe Issuance And Notarial Date Of The Authority Of The Signatory Shall Be The Same/shall Come First Before The Issuance And Notarial Date Of The Omnibus Sworn Statement. Note: Incomplete Submission Of The Required Documents Will Be A Ground For Disqualification. For Any Clarification, You May Contact Us At The Contact Information Provided: Mae Marie E. Hernandez Bac Secretariat Head (632) 8807-2628 To 32 Loc. 210 And/or 240 E-mail Address: Procurement@ritm.gov.ph / Procurement_02@ritm.gov.ph Website: Www.ritm.gov.ph Instructions: Note: Failure To Follow These Instructions Will Disqualify Your Entire Quotation. (1)do Not Alter The Contents Of This Form In Any Way. (2)the Use Of This Rfq Is Highly Encouraged To Minimize Errors Or Omissions Of The Required Mandatory Provisions. If Another Form Is Used Other Than The Latest Rfq, The Quotation Shall Contain All The Mandatory Requirements/provisions Including Manifestation On The Agreement With The Terms And Conditions Below. (3)all Technical Specifications Must Be Complied With. Failure To Comply With The Mandatory Requirements Shall Render The Quotation Ineligible/disqualified. (4)quotations May Be Submitted Through Electronic Mail At: Procurement@ritm.gov.ph / Procurement_02@ritm.gov.ph. (5)quotations, Including Documentary Requirements, Received After The Deadline Shall Not Be Accepted. For Quotations Submitted Via Electronic Mail, The Date And Time Of Receipt Indicated In The Email Shall Be Considered. Terms And Conditions: bidders Shall Provide Correct And Accurate Information Required In This Form. any Interlineations, Erasures, Or Overwriting Shall Be Valid Only If They Are Signed Or Initialed By You Or Any Of Your Duly Authorized Representative/s. price Quotation/s, To Be Denominated In Philippine Peso, Shall Include All Taxes, Duties, And/or Levies Payable – If Applicable. quotations Exceeding The Approved Budget For The Contract Shall Be Rejected. in Case Of Two Or More Bidders Are Determined To Have Submitted The Lowest Calculated Quotation/lowest Calculated And Responsive Quotation, The Ritm-bac Shall Adopt And Employ “draw Lots” As The Tie-breaking Method To Finally Determine The Single Winning Provider In Accordance With Gppb Circular 06-2005. award Of Contract Shall Be Made To The Lowest Quotation Which Complies With The Technical Specifications, Requirements And Other Terms And Conditions Stated Herein. payment Shall Be Made After Delivery And Upon The Submission Of The Required Supporting Documents, I.e., Order Slip And/or Billing Statement, By The Supplier, Contractor, Or Consultant. Our Government Servicing Bank, I.e., The Land Bank Of The Philippines, Shall Credit The Amount Due To The Identified Bank Account Of The Supplier, Contractor, Or Consultant Not Earlier Than Twenty-four (24) Hours, But Not Later Than Forty-eight (48) Hours, Upon Receipt Of Our Advice. Please Note That The Corresponding Bank Transfer Fee, If Any, Shall Be Chargeable To The Account Of The Supplier, Contractor, Or Consultant. liquidated Damages Equivalent To One-tenth Of One Percent (0.1%) Of The Value Of The Goods Not Delivered Within The Prescribed Delivery Period Shall Be Imposed Per Day Of Delay. Ritm May Terminate The Contract Once The Cumulative Amount Of Liquidated Damages Reaches Ten Percent (10%) Of The Amount Of The Contract, Without Prejudice To Other Courses Of Action And Remedies Available To The Procuring Entity. Technical Offer/proposal: After Having Carefully Read And Accepted The Instructions And Terms And Conditions, I/we Submit Our Technical Proposals/quotations For The Item/s As Follows: Item # Qty/ Unit Item Description Supplier’s Compliance (indicate Brand And/or Model, Including Complete Specifications To Be Offered - Applicable) 1 1/pack Agar, Chromatogenic For Candida Including Candida Auris, Dehydrated, 5000ml/pack General Requirements: • Product Brochure/product Information (if Applicable) •certificate Of Analysis, Quality Control And Conformity With Expiry Date And Batch Number 2 3/bottle Agar, Clostridium Difficile (agar Base), Same Brand As Supplement, 500 Grams/bottle Expiration Date: Shall Not Be Less Than Two (2) Years From The Date Of The Actual Delivery. *item Should Have Passed The Evaluation Result, Quality Assessment, And Quality Validation/verification Of The End-user Or Should Have Met The Acceptability Criteria Necessary For Laboratory Inter-comparability Of Results, Whichever Is Applicable. General Requirements: • Product Brochure/product Information (if Applicable) •certificate Of Analysis, Quality Control And Conformity With Expiry Date And Batch Number 3 1/pack Agar, Perfringens Agar Base (same Brand As Supplement), 5 Vials/pack Expiration Date: Shall Not Be Less Than Two (2) Years From The Date Of The Actual Delivery. *item Should Have Passed The Evaluation Result, Quality Assessment, And Quality Validation/verification Of The End-user Or Should Have Met The Acceptability Criteria Necessary For Laboratory Inter-comparability Of Results, Whichever Is Applicable. General Requirements: • Product Brochure/product Information (if Applicable) •certificate Of Analysis, Quality Control And Conformity With Expiry Date And Batch Number 4 2/bottle Agar, Sabouraud Dextrose, 4% Dextrose, Dehydrated Powder, 500 Grams/bottle General Requirements: • Product Brochure/product Information (if Applicable) •certificate Of Analysis, Quality Control And Conformity With Expiry Date And Batch Number 5 1/bottle Agar, Yersinia Selective (cin), Dehydrated Powder, 500 Grams/bottle General Requirements: • Product Brochure/product Information (if Applicable) •certificate Of Analysis, Quality Control And Conformity With Expiry Date And Batch Number 6 1/bottle Broth, For Culture, Brilliant Green Bile Broth 2%, 500 Gram/bottle Expiration Date: Shall Not Be Less Than Two (2) Years From The Date Of The Actual Delivery *item Should Have Passed The Evaluation Result, Quality Assessment, And Quality Validation/verification Of The End-user Or Should Have Met The Acceptability Criteria Necessary For Laboratory Inter-comparability Of Results, Whichever Is Applicable. General Requirements: •certificate Of Analysis •quality Control And Conformity With Expiry Date And Batch Number 7 1/bottle Buffer, Solution, Ph 4, 480 Ml/bottle Expiration Date: Shall Not Be Less Than Two (2) Years From The Date Of The Actual Delivery 8 1/bottle Buffer, Solution, Ph 7, 500 Ml/bottle Expiration Date: Shall Not Be Less Than Two (2) Years From The Date Of The Actual Delivery 9 1/bottle Buffer, Solution, Ph10, 500 Ml/bottle Expiration Date: Shall Not Be Less Than Two (2) Years From The Date Of The Actual Delivery 10 1/bottle Buffer, Tween 20, Viscous Liquid, Non-ionic Detergent, 500 Ml In Poly Bottle 11 2/vial Custom Oligonucleotide Synthesis, Pcr Primer (forward), Β-actin Gene Gh20.p (5'-gaa Gag Cca Agg Aca Ggt Ac-3'), 200 Nmol Scale, Mpoc Purification, 20 Bases, Vial 12 1/vial Custom Oligonucleotide Synthesis, Pcr Probe, Staphylococcus Aureus Enterotoxin D (entd), 200 Nmole , Entd-pr , (5'fam-tta Agg Gtg Att Ttc Ccg Aaa Aac Aat Tac Gaa Ta-3'bhq1), 35 Bases, Vial 13 2/vial Pcr Primer, Custom Oligonucleotide Synthesis, Rabv-f955 (phil-1) (5'atgggtcaagtcagatctctaaatgc'3) 100 Nmol Scale, Vial 14 1/vial Pcr Reagent, Custom Oligonucleotide Synthesis, Lyophilized Primer, 3'utr Taqman Prb (fam-ccatttagtcatccatcgtatccgaacgc-tam); Standard Desalting, 100 Nmol Scale General Requirements: • Product Brochure/product Information (if Applicable) •certificate Of Analysis 15 1/vial Pcr Reagent, Custom Oligonucleotide Synthesis, Lyophilized Primer, Ns3 Taqman Prb F (tggtcaacgtccagacaaaaccgagcttg); Standard Desalting, 100 Nmol Scale General Requirements: • Product Brochure/product Information (if Applicable) •certificate Of Analysis 16 1/vial Pcr Reagent, Custom Oligonucleotide Synthesis, Lyophilized Probe, Cchf Se01 Broad Range (100 Nm) Primetime Prb 5'6famtm/ 3'tamratm (56-fam-atctacatgcaccctgctgtgttgaca-36-tamsp; Hplc Purification, Vial 17 1/vial Pcr Reagent, Custom Oligonucleotide Synthesis, Lyophilized Probe, Cchf Se03 Addi 100 Nm Primetime 5'6famtm/ 3'tamratm (56-fam-atttacatgcaccctgccgtgcttaca-36tamsp); Hplc Purification, 100 Nmol Scale, Vial Financial Offer/proposal: Please Quote Your Best Offer For The Item/s Below. Please Do Not Leave Any Blank Items. Indicate “0” If Item Being Offered Is For Free: Item # Qty/ Unit Item Description Abc Price Proposal Unit Cost Price Proposal Total Cost 1 1/pack Agar, Chromatogenic For Candida Including Candida Auris, Dehydrated, 5000ml/pack General Requirements: • Product Brochure/product Information (if Applicable) •certificate Of Analysis, Quality Control And Conformity With Expiry Date And Batch Number 47,520.00 2 3/bottle Agar, Clostridium Difficile (agar Base), Same Brand As Supplement, 500 Grams/bottle Expiration Date: Shall Not Be Less Than Two (2) Years From The Date Of The Actual Delivery. *item Should Have Passed The Evaluation Result, Quality Assessment, And Quality Validation/verification Of The End-user Or Should Have Met The Acceptability Criteria Necessary For Laboratory Inter-comparability Of Results, Whichever Is Applicable. General Requirements: • Product Brochure/product Information (if Applicable) •certificate Of Analysis, Quality Control And Conformity With Expiry Date And Batch Number 54,000.00 3 1/pack Agar, Perfringens Agar Base (same Brand As Supplement), 5 Vials/pack Expiration Date: Shall Not Be Less Than Two (2) Years From The Date Of The Actual Delivery. *item Should Have Passed The Evaluation Result, Quality Assessment, And Quality Validation/verification Of The End-user Or Should Have Met The Acceptability Criteria Necessary For Laboratory Inter-comparability Of Results, Whichever Is Applicable. General Requirements: • Product Brochure/product Information (if Applicable) •certificate Of Analysis, Quality Control And Conformity With Expiry Date And Batch Number 6,800.00 4 2/bottle Agar, Sabouraud Dextrose, 4% Dextrose, Dehydrated Powder, 500 Grams/bottle General Requirements: • Product Brochure/product Information (if Applicable) •certificate Of Analysis, Quality Control And Conformity With Expiry Date And Batch Number 4,622.20 5 1/bottle Agar, Yersinia Selective (cin), Dehydrated Powder, 500 Grams/bottle General Requirements: • Product Brochure/product Information (if Applicable) •certificate Of Analysis, Quality Control And Conformity With Expiry Date And Batch Number 7,830.90 6 1/bottle Broth, For Culture, Brilliant Green Bile Broth 2%, 500 Gram/bottle Expiration Date: Shall Not Be Less Than Two (2) Years From The Date Of The Actual Delivery *item Should Have Passed The Evaluation Result, Quality Assessment, And Quality Validation/verification Of The End-user Or Should Have Met The Acceptability Criteria Necessary For Laboratory Inter-comparability Of Results, Whichever Is Applicable. General Requirements: •certificate Of Analysis •quality Control And Conformity With Expiry Date And Batch Number 3,685.00 7 1/bottle Buffer, Solution, Ph 4, 480 Ml/bottle Expiration Date: Shall Not Be Less Than Two (2) Years From The Date Of The Actual Delivery 797.50 8 1/bottle Buffer, Solution, Ph 7, 500 Ml/bottle Expiration Date: Shall Not Be Less Than Two (2) Years From The Date Of The Actual Delivery 797.50 9 1/bottle Buffer, Solution, Ph10, 500 Ml/bottle Expiration Date: Shall Not Be Less Than Two (2) Years From The Date Of The Actual Delivery 797.50 10 1/bottle Buffer, Tween 20, Viscous Liquid, Non-ionic Detergent, 500 Ml In Poly Bottle 1,210.00 11 2/vial Custom Oligonucleotide Synthesis, Pcr Primer (forward), Β-actin Gene Gh20.p (5'-gaa Gag Cca Agg Aca Ggt Ac-3'), 200 Nmol Scale, Mpoc Purification, 20 Bases, Vial 920.00 12 1/vial Custom Oligonucleotide Synthesis, Pcr Probe, Staphylococcus Aureus Enterotoxin D (entd), 200 Nmole , Entd-pr , (5'fam-tta Agg Gtg Att Ttc Ccg Aaa Aac Aat Tac Gaa Ta-3'bhq1), 35 Bases, Vial 22,710.00 13 2/vial Pcr Primer, Custom Oligonucleotide Synthesis, Rabv-f955 (phil-1) (5'atgggtcaagtcagatctctaaatgc'3) 100 Nmol Scale, Vial 1,540.00 14 1/vial Pcr Reagent, Custom Oligonucleotide Synthesis, Lyophilized Primer, 3'utr Taqman Prb (fam-ccatttagtcatccatcgtatccgaacgc-tam); Standard Desalting, 100 Nmol Scale General Requirements: • Product Brochure/product Information (if Applicable) •certificate Of Analysis 800.00 15 1/vial Pcr Reagent, Custom Oligonucleotide Synthesis, Lyophilized Primer, Ns3 Taqman Prb F (tggtcaacgtccagacaaaaccgagcttg); Standard Desalting, 100 Nmol Scale General Requirements: • Product Brochure/product Information (if Applicable) •certificate Of Analysis 800.00 16 1/vial Pcr Reagent, Custom Oligonucleotide Synthesis, Lyophilized Probe, Cchf Se01 Broad Range (100 Nm) Primetime Prb 5'6famtm/ 3'tamratm (56-fam-atctacatgcaccctgctgtgttgaca-36-tamsp; Hplc Purification, Vial 40,000.00 17 1/vial Pcr Reagent, Custom Oligonucleotide Synthesis, Lyophilized Probe, Cchf Se03 Addi 100 Nm Primetime 5'6famtm/ 3'tamratm (56-fam-atttacatgcaccctgccgtgcttaca-36tamsp); Hplc Purification, 100 Nmol Scale, Vial 40,000.00 Delivery Period: One Fifty (150) Calendar Days Total Offered Quotation In Words: ______________ In Figures: ______________ Price Validity: ________________ Payment Terms: Thirty (30) Calendar Days Payment Details: Banking Institution: _________________________________________________ Account Number: __________________________________________________ Account Name: _________________________________________________ Branch: _________________________________________________ Note: Only The Actual Amount Of The Accepted Items Shall Be Paid. ___________________________ Signature Over Printed Name Of Authorized Representative ___________________________ Position/designation ___________________________ Office Telephone/fax/mobile Nos. ___________________________ Email Address/es