Tenders of National Institute Of Pharmaceutical Education And Research
... More
Get the latest updates on NIPER tenders for various goods and services to grab the best opportunities. At present, a large number of active business opportunities are available through National Institute Of Pharmaceutical Education And Research tenders. These tenders are made available for public bidding through the official NIPER eProcurement portal. To keep track of new National Institute Of Pharmaceutical Education And Research tenders, you need to regularly check the portal or sign up on BidAssist for regular notifications. You can get all the details on eligibility, tender value, submission dates, and documents required to bid on the most relevant National Institute Of Pharmaceutical Education And Research tenders.
National Institute Of Pharmaceutical Education And Research - NIPER Tender
GEM
S.a.s Nagar, Punjab
Closing Date30 Jan 2025
Tender Amount₹ 28.5 K This is an estimated amount, exact amount may vary.
CATEGORY: Labware 1 , Labware 2 , Labware 3 , Labware 4 , Labware 5
, Labware 6 , Labware 7 , Labware 8 , Labware 9 , Labware
10 , Labware 11 , Labware 12 , Labware 13 , Labware 14 ,
Labware 15 , Labware 16 , Labware 17 , Labware 18 ,
Labware 19 , Labware 20 , Labware 21
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Electrical Works...+1Electrical and Electronics
GEM
Medchal Malkajgiri, Telangana
Closing Date14 Feb 2025
Tender Amount₹ 2 Lac This is an estimated amount, exact amount may vary.
Annual Maintenance Service-air Conditioner
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Chemical Products
GEM
S.a.s Nagar, Punjab
Closing Date28 Jan 2025
Tender Amount₹ 1 Lac This is an estimated amount, exact amount may vary.
CATEGORY: Chemical 1 , Chemical 2 , Chemical 3 , Chemical 4 ,
Chemical 5 , Chemical 6 , Chemical 7 , Chemical 8 ,
Chemical 9 , Chemical 10 , Chemical 11 , Chemical 12 ,
Chemical 13 , Chemical 14 , Chemical 15 , Chemical 16 ,
Chemical 17 , Chemical 18 , Chemical 19 , Chemical 20 ,
Chemical 21 , Chemical 22 , Chemical 23 , Chemical 24 ,
Chemical 25 , Chemical 26 , Chemical 27 , Chemical 28
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Healthcare and Medicine
GEM
S.a.s Nagar, Punjab
Closing Date24 Feb 2025
Tender AmountRefer Documents
CATEGORY: FAM labelled miRNA let 7b 5p mimic (hsa let 7b 5p) Mature
miRNA Sequence UGAGGUAGUAGGUUGUGUGGUU, 100 ,
miRNA let 7b 5p inhibitor Mature miRNA Sequence
UGAGGUAGUAGGUUGUGUGGUU, 100 nm , miRNA let 7b 5p
mimic (hsa let 7b 5p) Mature miRNA Sequence
UGAGGUAGUAGGUUGUGUGGUU, 100 nm
National Institute Of Pharmaceutical Education And Research - NIPER Tender
GEM
Kamrup, Assam
Closing Date3 Feb 2025
Tender Amount₹ 15.9 Lac This is an estimated amount, exact amount may vary.
Customized Amc/cmc For Pre-owned Products - Lcms; Waters Xevo Tqxs; Annual Maintenance Contract (am
National Institute Of Pharmaceutical Education And Research - NIPER Tender
GEM
S.a.s Nagar, Punjab
Closing Date15 Feb 2025
Tender Amount₹ 93.6 K This is an estimated amount, exact amount may vary.
CATEGORY: Chemical 1 , Chemical 2 , Chemical 3 , Chemical 4 ,
Chemical 5 , Chemical 6 , Chemical 7 , Chemical 8 ,
Chemical 9 , Chemical 10 , Chemical 11 , Chemical 12 ,
Chemical 13 , Chemical 14 , Chemical 15 , Chemical 16 ,
Chemical 17 , Chemical 18 , Chemical 19 , Chemical 20 ,
Chemical 21 , Chemical 22 , Chemical 23 , Chemical 24 ,
Chemical 25 , Chemical 26 , Chemical 27 , Chemical 28 ,
Chemical 29 , Chemical 30 , Chemical 31 , Chemical 32 ,
Chemical 33 , Chemical 34 , Chemical 35
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Software and IT Solutions
GEM
Kamrup, Assam
Closing Date1 Feb 2025
Tender Amount₹ 15.9 Lac This is an estimated amount, exact amount may vary.
Customized Amc/cmc For Pre-owned Products - Confocal Work Station; Tcs Sp 8; Comprehensive Maintena
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Machinery and Tools...+2Electrical Goods and Equipments, Electrical and Electronics
Eprocure
Medchal Malkajgiri, Telangana
Closing Date4 Mar 2025
Tender AmountRefer Documents
Supply And Installation Of Spare Parts For Heidolph Rotary Evaporator (small)
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Software and IT Solutions
Eprocure
Medchal Malkajgiri, Telangana
Closing Date4 Mar 2025
Tender AmountRefer Documents
Comprehensive Maintainance Contract (cmc) For Agilent Hplc System With Spares
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Chemical Products
GEM
Kamrup, Assam
Closing Date28 Feb 2025
Tender AmountRefer Documents
CATEGORY: Industrial grade Lyophilizer
471-480 of 544 archived Tenders
Tenders By Authorities
Indian Army Tenders
Public Works Department Tenders
Zilla Parishad Tenders
Military Engineer Services Tenders
Public Health Engineering Department Tenders
Municipal Corporation Tenders
Local Self Government Department Tenders
Canara Bank Tenders
Directorate Of Urban Local Bodies Tenders
Rural Development & Panchayati Raj Department Tenders
Show More