Tenders of National Institute Of Pharmaceutical Education And Research
Get the latest updates on NIPER tenders for various goods and services to grab the best opportunities. At present, a large number of active business opportunities are available through National Institute Of Pharmaceutical Education And Research tenders. These tenders are made available for public bidding through the official NIPER eProcurement portal. To keep track of new National Institute Of Pharmaceutical Education And Research tenders, you need to regularly check the portal or sign up on BidAssist for regular notifications. You can get all the details on eligibility, tender value, submission dates, and documents required to bid on the most relevant National Institute Of Pharmaceutical Education And Research tenders.
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Goods
Healthcare and Medicine
GEM
S.a.s Nagar, Punjab
CATEGORY: PAMPA Membrane , GIT Activating Phospholipid , Permeapad
Closing Date6 Feb 2025
Tender Amount₹ 2.7 Lac
This is an estimated amount, exact amount may vary.
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Goods
GEM
Corrigendum : Corrigendum Added
S.a.s Nagar, Punjab
CATEGORY: Labware 1 , Labware 2 , Labware 3 , Labware 4 , Labware 5
, Labware 6 , Labware 7 , Labware 8 , Labware 9 , Labware
10 , Labware 11 , Labware 12 , Labware 13 , Labware 14 ,
Labware 15 , Labware 16 , Labware 17 , Labware 18 ,
Labware 19 , Labware 20 , Labware 21
Closing Date30 Jan 2025
Tender Amount₹ 28.5 K
This is an estimated amount, exact amount may vary.
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Services
Electrical Works...+1Electrical and Electronics
GEM
Medchal Malkajgiri, Telangana
Annual Maintenance Service-air Conditioner
Closing Date14 Feb 2025
Tender Amount₹ 2 Lac
This is an estimated amount, exact amount may vary.
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Goods
Chemical Products
GEM
Corrigendum : Corrigendum Added
S.a.s Nagar, Punjab
CATEGORY: Chemical 1 , Chemical 2 , Chemical 3 , Chemical 4 ,
Chemical 5 , Chemical 6 , Chemical 7 , Chemical 8 ,
Chemical 9 , Chemical 10 , Chemical 11 , Chemical 12 ,
Chemical 13 , Chemical 14 , Chemical 15 , Chemical 16 ,
Chemical 17 , Chemical 18 , Chemical 19 , Chemical 20 ,
Chemical 21 , Chemical 22 , Chemical 23 , Chemical 24 ,
Chemical 25 , Chemical 26 , Chemical 27 , Chemical 28
Closing Date28 Jan 2025
Tender Amount₹ 1 Lac
This is an estimated amount, exact amount may vary.
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Goods
Healthcare and Medicine
GEM
S.a.s Nagar, Punjab
CATEGORY: FAM labelled miRNA let 7b 5p mimic (hsa let 7b 5p) Mature
miRNA Sequence UGAGGUAGUAGGUUGUGUGGUU, 100 ,
miRNA let 7b 5p inhibitor Mature miRNA Sequence
UGAGGUAGUAGGUUGUGUGGUU, 100 nm , miRNA let 7b 5p
mimic (hsa let 7b 5p) Mature miRNA Sequence
UGAGGUAGUAGGUUGUGUGGUU, 100 nm
Closing Date24 Feb 2025
Tender AmountRefer Documents
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Services
GEM
Kamrup, Assam
Customized Amc/cmc For Pre-owned Products - Lcms; Waters Xevo Tqxs; Annual Maintenance Contract (am
Closing Date3 Feb 2025
Tender Amount₹ 15.9 Lac
This is an estimated amount, exact amount may vary.
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Goods
GEM
S.a.s Nagar, Punjab
CATEGORY: Chemical 1 , Chemical 2 , Chemical 3 , Chemical 4 ,
Chemical 5 , Chemical 6 , Chemical 7 , Chemical 8 ,
Chemical 9 , Chemical 10 , Chemical 11 , Chemical 12 ,
Chemical 13 , Chemical 14 , Chemical 15 , Chemical 16 ,
Chemical 17 , Chemical 18 , Chemical 19 , Chemical 20 ,
Chemical 21 , Chemical 22 , Chemical 23 , Chemical 24 ,
Chemical 25 , Chemical 26 , Chemical 27 , Chemical 28 ,
Chemical 29 , Chemical 30 , Chemical 31 , Chemical 32 ,
Chemical 33 , Chemical 34 , Chemical 35
Closing Date15 Feb 2025
Tender Amount₹ 93.6 K
This is an estimated amount, exact amount may vary.
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Services
Software and IT Solutions
GEM
Kamrup, Assam
Customized Amc/cmc For Pre-owned Products - Confocal Work Station; Tcs Sp 8; Comprehensive Maintena
Closing Date1 Feb 2025
Tender Amount₹ 15.9 Lac
This is an estimated amount, exact amount may vary.
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Goods
Machinery and Tools...+2Electrical Goods and Equipments, Electrical and Electronics
Eprocure
Medchal Malkajgiri, Telangana
Supply And Installation Of Spare Parts For Heidolph Rotary Evaporator (small)
Closing Date4 Mar 2025
Tender AmountRefer Documents
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Services
Software and IT Solutions
Eprocure
Medchal Malkajgiri, Telangana
Comprehensive Maintainance Contract (cmc) For Agilent Hplc System With Spares
Closing Date4 Mar 2025
Tender AmountRefer Documents
471-480 of 545 archived Tenders