Tender Results of Sikkim University
Select Contract Period
2024 onwards
2022 onwards
All Time
Sikkim University Tender Result
GEM
East Sikkim, Sikkim
Contract Date6 Feb 2024 This is an estimated contract date, exact date may vary.
Contract Amount₹ 5.2 Lac
CATEGORY: 2 2 Bipyridine , 4-mercaptobenzoic acid , Acetone , Adenine
, Amine functionalized graphene , Carbon Tetra Chloride ,
Ethanol 99 percent , Ethylene Glycol , Fullerene C 60 98
percent , Graphene , Graphene nanoribbon , Isopropyl
alcohol , Lead II Chloride , Lead II nitrate , Mercury II
Chloride , Mercury II nitrate monohydrate , Methanol , m
xylene anhydrous , N N Dimethylformamide anhydrous 99
percent , PEDOT PSS , Phenylhydrazine , Rodamine 6G ,
Silver Nitrate , Sodium borohydride , sodium dodecyl sulfate
, Thiophenol , Titanium III chloride solution , Titanium nitride
, Toluene , Aluminium Foil , Batteries 9 V , Batteries AA ,
Batteries AAA , BOROSILICATE GLASS VACUUM BUCHNER
FILTER FUNNEL WITH CONE. G3 , Clipper and Clampers
Trainer NV6511 , Extension Strip , Hair Dryer , Hand gloves ,
Laboratory Cleaning Towel , Multimeter , Napkin paper ,
Parafilm , Pen Drive , Round Bottom Flask with
interchangeable joint made of 3.3 borosilicate glass For
Rota Vac , Table Duster , Teflon tape White , Tissue paper
roll , Torch Lights , Wien Bridge
Sikkim University Tender Result
Housekeeping Services
Eprocure
East Sikkim, Sikkim
Contract Date15 Jul 2024
Contract Amount₹ 2.8 Lac This is an estimated amount, exact amount may vary.
Etender Notice For Various Maintenance Work At The Guest House, Sikkim University
Sikkim University Tender Result
Furnitures and Fixtures
GEM
East Sikkim, Sikkim
Contract DateNA
Contract Amount₹ 2.6 Lac
CATEGORY: STUDY TABLE , COMPUTER TABLE , CHAIR , Book shelve ,
Insect Growth Chamber
Sikkim University Tender Result
GEM
East Sikkim, Sikkim
Contract Date6 Feb 2024 This is an estimated contract date, exact date may vary.
Contract AmountRefer Documents
CATEGORY: Tributyl1-ethoxyvinyl tin , 35 Dibromobenzaldehyde , 5
Methyl 1 10 phenanthroline , Potassium tertiary butoxide ,
NBS , Trifluoromethane Sulfonic Acid , Potassium
tetrachloroaurate iii , Palladium Acetate , 2 Aminopyridine ,
1 10 Phenanthroline , Ethanol amine , Cisteamine
Hydrochloride , 2Methacrylic Acid , 2Aminothiophenol ,
Tetra butyl ammonium perchlorate , N phenylglycine ,
Methylbromide , Dibromomethane , 2 bromoacetylbromide ,
2Bromobenzoic acid , 2Bromo 3 nitrobenzoic acid , 2
Iodobenzoic acid , N N Dimethylaniline , E Buta 13 dien
1ylbenzene , E 3 4 Chlorophenyl acrylaldehyde , E 3 4
Methoxyphenyl acrylaldehyde , Isopropyl Alcohol HPLC
grade , N Hexane HPLCgrade 99percentage ,
Paraformaldehyde , Ethyl bromoacetate , DRY Toluene , N
pentane , Cesium Carbonate , Chloroform D ,
Cinnamaldehyde 3 Phenylacrylaldehyde , 1Bromo 3 fluoro-5
nitrobenzene , 3 Phenylpropanoic acid , 2 3 Benzofuran ,
Methyl acetate , Triglyme , L Glutathione 98percent , methyl
4 iodobenzoate , methyl 1H- indole 6 carboxylate , 5 4
Carboxyphenyl 1 1 3 1 terphenyl 44 dicarboxylic acid
95percentage , 1Methylimidazole 98percentage ,
334Dihydroxyphenyl acrylic acid 98 percentage ,
Polyvinylpyrrolidone k 30 , L Epicatechin , 5 4
Carboxyphenyl 2 methyl 11 3 1 terphenyl 4 4 dicarboxylic
acid 98 percentage , 4 5 Bis 3 carboxyphenyl 1 1 2 1
terphenyl 3 3 dicarboxylic acid 98 percentage , 5 3 5
Dicarboxyphenyl-1 1 3 1 terphenyl 3 3 5 5 tetracarboxylic
acid 98 percentage , L Adrenaline , Methyl indole
3carboxylate 98 percentage , Iron II chloride tetrahydrate ,
4 Dimethylaminopyridine , 55 Dimethyl 1 pyrroline N oxide,
97 percentage , 3355 Tetramethyl 11 biphenyl 4 4 diamine
98 percentage , 5 5 Dimethyl 2 2 bipyridine 98 percentage ,
2 4 Dichlorophenol, 98 percentage , Glucose Oxidase
Aspergillus Niger , 1h Pyrazole 4 carboxylic acid 98 , 2
Nitroimidazole, 99 percentage , Iodomethane, 98
percentage , 3 3 4 Dihydroxyphenylacrylic acid 98
percentage , 4 Iodobenzoic acid 97 percentage , Copper I
acetate 97 percentage , 6 6 Dimethyl 2 2 bipyridine 98
percentage , 4 4 Dimethyl 2 2 bipyridine 98 percentage , N
Pentane 99 percentage , 1 10 Phenanthroline 98 percentage
, Hydrogen peroxide 30 percentage , Tert Butyl
hydroperoxide, 70 percentage aqueous solution , 4 tert
Butylcatechol 98 percentage , Acetonitrile HPLC Grade , 2
Amino 4 6 dimethylpyrimidine , Nicotinic Acid hydrazide , 3
Hydroxy 2 naphthoic Acid Hydrazide , 8 Hydroxyjulolidine 9
carboxaldehyde , Diaminomaleonitrile , 2 hydroxy 3
methoxybenzaldehyde , 1 2 4 Triazole 3 5 diamine ,
Pyrazinoic acid hydrazide , 3 5 di tert butyl 2
hydroxybenzaldehyde , 2 Hydroxy 1 naphthaldehyde , 3
amino 1 2 4 triazole , 3 Amino 5 methylthio-1H-1 2 4 triazole
, 2 2 Dimethyl 1 3 propanediamine , Terephthalaldehyde , 4
aminoazobenzene , 2 Hydrazinyl 4 6 dimethylpyrimidine ,
Cyclopropanecarbohydrazide , Pivalohydrazide , 2
Thiophenecarboxylic acid hydrazide , 2 Furoic hydrazide , 2
6 Diacetylpyridine , 2 Acetylpyridine , Quinoline 2
carboxaldehyde
Sikkim University Tender Result
GEM
East Sikkim, Sikkim
Contract Date30 Jan 2024 This is an estimated contract date, exact date may vary.
Contract Amount₹ 2.4 Lac
CATEGORY: DEPC Diethyl pyrocarbonate , Rnasezap , PCR master mix
Green , Rneasy plant mini Mini Kit 50 , 10x Dnase I reaction
buffer , Quantabio qScript cDNA supermix , Quantitech
SYBR Green PCR kit 200 , StepUp 250bp DNA Ladder 100
loads 50 microgm , RNA later , DNase I Rnase free , Diluent
for DNA Extraction , Jasmonic acid , Formic Acid , nylon
syringe filters Polyethersulfone PES Syringe Filters 02 Micron
25mm , Cryo tags , Nitrile gloves , RT PCR plates 96 wells ,
Microseal Bseal Seals , Autoclavable bags 12 by 24 ,
Autoclavable bags 14by 19
Sikkim University Tender Result
GEM
East Sikkim, Sikkim
Contract Date17 Jan 2024 This is an estimated contract date, exact date may vary.
Contract Amount₹ 3.2 Lac
CATEGORY: Beaker Glass , Conical Flask Narrow mouth , Culture tubes
flat bottom screw cap , Culture Tubes flat bottom screw cap
, culture tubes flat bottom screw cap , Measuring Cylinder
Glass , Micropippette , Micropippetes , Microtip zero point 2
to 10 microlitre , Microtip 2 to 200 microlitre , Microtip 200
to1000 microlitre , Microtip Box zero point 2 to10 microlitre ,
Microtip Box 2 to 200 micro litre , Microtip Box 200 to 1000
micro litre , PCR tubes zero point 2ml flat cap ,
Microcentrifuge tube 1point5ml , Microcentrifuge tube 2ml ,
cryo vial 100 places , PCR Rack , MicroPippete rack Z type ,
Test Tube , Test tube , Centrifuge tube conical bottom ,
Float rack Cryo vial , PCR workstation , HPLC vials amber
clear , Microscope slide box , pellet pestles micro pestles ,
Eppendorf tube rack , pycnometer , Glass rod , instrument
sterilizing pan autoclavable , Biohazard waste container ,
zero degree mini cooler PC with non toxic gel , Gloves nitrile
gloves Long cuff Tarson , nitrile gloves Tarson , surgical
mask , Magnetic Retriever , Polygon Magnetic Stirrer Bar ,
Parrafilm M 5cm , motar and pestle , Aluminium Foil , Tissue
Paper , Vetroclean , Colour charts for plants , tough tags
with station , Autoclavable bag bio hazard
Sikkim University Tender Result
GEM
East Sikkim, Sikkim
Contract Date17 Jan 2024 This is an estimated contract date, exact date may vary.
Contract Amount₹ 1.4 Lac
Forward Acgagctaaagctcattagggtaa Reversetcggcaagaatacaaagtgagtaa,forward Ggatcgttcctttttagggtaat Re
Sikkim University Tender Result
Chemical Products
GEM
East Sikkim, Sikkim
Contract Date17 Jan 2024 This is an estimated contract date, exact date may vary.
Contract Amount₹ 4.1 Lac
CATEGORY: 3 5 Dinitrosalicylic Acid , 6 Benzyl Adenine BAP , Absisic
Acid , Acetic Acid Glacial , Adenine Sulphate Dihydrate ,
Aluminium Standard , Ammonium Dihydrogen Phosphate
GR , Ammonium Ferrous Sulphate , Ammonium
Monohydrate , Ammonium Persulfate , Ammonium
Phosphate Monobasic , Ammonium Sulphate GR ,
Ammonium thiocyanate , Amylum , Anthrone reagent ,
Antimony Trichloride , Arsenic Standard , Boric Acid GR Pure
, Boron Standard , Bovine Serum Albumin , Bromocresol
Green Indicator , Bromophenol Blue , Bromothymol Blue
Solution , Butylated Hydroxytoluene , Cadmium Standard ,
Caffeic acid , Calcium Standard , Carbon Tetrachloride ,
Cobalt II Chloride heptahydrate , Cobalt Standard , Copper
chloride , Cresol Red , Curcumin , Cysteine L Cysteine , D
plus Glucose Dextrose monohydrate AR , Disodium
Hydrogen Phosphate , Disodium Hydrogen Phosphate
Dihydrate , DTPA Diethylenetriamine Penta Acetic Acid ,
Dinitrosalicylic acid , Diphenylamine AR , Dragendorffs
Reagent , EDTA Ferric monosodium Salt , EDTA Disodium
salt Dihydrate MB Grade , Ferric Citrate monohydrate , Folic
acid , Gallic acid monohydrate , Green Master Mix ,
Hydrochloric Acid HCl , Indol 3 Butyric Acid , Indole 3 Acetic
Acid , Iron II Chloride Tetrahydrate Ferrous Chloride , Iron III
Chloride Ferric Chloride , Lead Standard Solution ,
Magnesium Standard , Methanol hplc grade , Molybdenum
Standard , Naphthalene Acetic Acid , Nitroblue tetrazolium
chloride , Nitrophenol AR Spectrophotometric grade p
nitrophenol , Phenolphthalein Indicator , Potassium
Phosphate Monobasic Potassium H2 Orthophosphate , DNA
LADDER 1kb , DNA LADDER 100bp , Sodium Hydroxide
NaOH , Sodium Hypochlorite Soln , Sodium Phosphate
Monobasic Monohydrate , Sodium Phosphate Dibasic
Heptahydrate , Sodium Standard , Tetrazolium salt , ICP
Multi standard Solution , mordant alum , Teepol , copper
sulphate , 2 6 Dicholrophenol , indophenol , potassium
thiocynate , ammonium metavanadate , beta carotene ,
Potassium sodium tartarate , oxalic acid , potassium
permanganate , zinc sulphate , citric acid anhydrous ,
acetone , Acetone molecular grade , sodium carbonate ,
phenol crystal , Phenopthalin indicator , Plant preservative
mixture tissue culture , 2napthoxyacetic acid , picloram ,
Polyvinylpyrrolidone PVP k30 , benzyl adenine BA , MS
Medium 100x1Ltr with cacl2 and vitamins sucrose and agar
, thiadiazuron TDZ , 2 4 D plant tissue culture tested , 4
methyl catechol , Ethidium bromide , Nuclease free water ,
Evans Blue , Trifluroacetic acid TFA HPLC grade , DEAE
cellulose HPLC grade , HPLC grade water , sodium phytate ,
sodium acetate trihydrate , p Nitrophenol , Tris buffer ,
sodium b glycerolphosphate , Acetonitrile HPLC grade ,
Ethyl acetate HPLC grade , 0 point2 micrometer membrane
filter1 for HPLC , Nylon filter membranes 0 point45
micrometer , Buffer Tablets pH 4 , Buffer Tablets pH 7 ,
Buffer tablets pH 9 , dendrobin , Safranine , 6X Gel loading
buffer , Ammonium Hydrogen phosphate
Sikkim University Tender Result
GEM
East Sikkim, Sikkim
Contract Date17 Jan 2024 This is an estimated contract date, exact date may vary.
Contract Amount₹ 1.9 Lac
CATEGORY: Blotting paper , seive 2mm with frame , Plastic pots nursery
pots , Plastic pots , Vermicompost , Green House Uv
stablized plastic , muslin cloth , Nursery bags black with
holes medium , thermo hygrometer digital RH temperature ,
Tensiometer , ordinary Rain gauge , Laboratory Apron heavy
duty , Foldable telescopic aluminium ladder , nylon brush
small , nylon brush large , safety goggles , spray bottle ,
Anti hail net , Bavistine , Plant label holder T type witn tilted
head , Maximum minimum thermometer
Sikkim University Tender Result
GEM
East Sikkim, Sikkim
Contract Date4 Jan 2024
Contract Amount₹ 33 Lac
CATEGORY: Desktop , WORKSTATION , Mini Centrifuge , Micro centrifuge
, PCR thermal cycler , Gel Imaging System , Electrophoresis
Power Supply Unit , minus 40 deep freezer , Portable
Electrical Incinerator , NanoSpectrophotometer , Point and
shoot bridge camera
81-90 of 158 active Tender Results
Tender Results By Authorities
Indian Army Tender Results
Public Works Department Tender Results
Zilla Parishad Tender Results
Military Engineer Services Tender Results
Local Self Government Department Tender Results
Municipal Corporation Tender Results
Panchayati Raj Department Tender Results
Directorate Of Urban Local Bodies Tender Results
South Central Railway Tender Results
Western Railway Tender Results
Show More