Tender Results of Sikkim University

Sikkim University Tender Result

Goods
GEM
Result Stage: Potential AOC Released
East Sikkim, Sikkim
Contract Date6 Feb 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 5.2 Lac 
CATEGORY: 2 2 Bipyridine , 4-mercaptobenzoic acid , Acetone , Adenine , Amine functionalized graphene , Carbon Tetra Chloride , Ethanol 99 percent , Ethylene Glycol , Fullerene C 60 98 percent , Graphene , Graphene nanoribbon , Isopropyl alcohol , Lead II Chloride , Lead II nitrate , Mercury II Chloride , Mercury II nitrate monohydrate , Methanol , m xylene anhydrous , N N Dimethylformamide anhydrous 99 percent , PEDOT PSS , Phenylhydrazine , Rodamine 6G , Silver Nitrate , Sodium borohydride , sodium dodecyl sulfate , Thiophenol , Titanium III chloride solution , Titanium nitride , Toluene , Aluminium Foil , Batteries 9 V , Batteries AA , Batteries AAA , BOROSILICATE GLASS VACUUM BUCHNER FILTER FUNNEL WITH CONE. G3 , Clipper and Clampers Trainer NV6511 , Extension Strip , Hair Dryer , Hand gloves , Laboratory Cleaning Towel , Multimeter , Napkin paper , Parafilm , Pen Drive , Round Bottom Flask with interchangeable joint made of 3.3 borosilicate glass For Rota Vac , Table Duster , Teflon tape White , Tissue paper roll , Torch Lights , Wien Bridge

Sikkim University Tender Result

Works
Housekeeping Services
Eprocure
Result Stage: Potential AOC Released
1 year ago
East Sikkim, Sikkim
Contract Date15 Jul 2024
Contract Amount₹ 2.8 Lac 
This is an estimated amount, exact amount may vary.
Etender Notice For Various Maintenance Work At The Guest House, Sikkim University

Sikkim University Tender Result

Goods
Furnitures and Fixtures
GEM
Result Stage: Potential AOC Released
East Sikkim, Sikkim
Contract DateNA
Contract Amount₹ 2.6 Lac 
CATEGORY: STUDY TABLE , COMPUTER TABLE , CHAIR , Book shelve , Insect Growth Chamber

Sikkim University Tender Result

Goods
GEM
Result Stage: Under Evaluation
East Sikkim, Sikkim
Contract Date6 Feb 2024
This is an estimated contract date, exact date may vary.
Contract AmountRefer Documents 
CATEGORY: Tributyl1-ethoxyvinyl tin , 35 Dibromobenzaldehyde , 5 Methyl 1 10 phenanthroline , Potassium tertiary butoxide , NBS , Trifluoromethane Sulfonic Acid , Potassium tetrachloroaurate iii , Palladium Acetate , 2 Aminopyridine , 1 10 Phenanthroline , Ethanol amine , Cisteamine Hydrochloride , 2Methacrylic Acid , 2Aminothiophenol , Tetra butyl ammonium perchlorate , N phenylglycine , Methylbromide , Dibromomethane , 2 bromoacetylbromide , 2Bromobenzoic acid , 2Bromo 3 nitrobenzoic acid , 2 Iodobenzoic acid , N N Dimethylaniline , E Buta 13 dien 1ylbenzene , E 3 4 Chlorophenyl acrylaldehyde , E 3 4 Methoxyphenyl acrylaldehyde , Isopropyl Alcohol HPLC grade , N Hexane HPLCgrade 99percentage , Paraformaldehyde , Ethyl bromoacetate , DRY Toluene , N pentane , Cesium Carbonate , Chloroform D , Cinnamaldehyde 3 Phenylacrylaldehyde , 1Bromo 3 fluoro-5 nitrobenzene , 3 Phenylpropanoic acid , 2 3 Benzofuran , Methyl acetate , Triglyme , L Glutathione 98percent , methyl 4 iodobenzoate , methyl 1H- indole 6 carboxylate , 5 4 Carboxyphenyl 1 1 3 1 terphenyl 44 dicarboxylic acid 95percentage , 1Methylimidazole 98percentage , 334Dihydroxyphenyl acrylic acid 98 percentage , Polyvinylpyrrolidone k 30 , L Epicatechin , 5 4 Carboxyphenyl 2 methyl 11 3 1 terphenyl 4 4 dicarboxylic acid 98 percentage , 4 5 Bis 3 carboxyphenyl 1 1 2 1 terphenyl 3 3 dicarboxylic acid 98 percentage , 5 3 5 Dicarboxyphenyl-1 1 3 1 terphenyl 3 3 5 5 tetracarboxylic acid 98 percentage , L Adrenaline , Methyl indole 3carboxylate 98 percentage , Iron II chloride tetrahydrate , 4 Dimethylaminopyridine , 55 Dimethyl 1 pyrroline N oxide, 97 percentage , 3355 Tetramethyl 11 biphenyl 4 4 diamine 98 percentage , 5 5 Dimethyl 2 2 bipyridine 98 percentage , 2 4 Dichlorophenol, 98 percentage , Glucose Oxidase Aspergillus Niger , 1h Pyrazole 4 carboxylic acid 98 , 2 Nitroimidazole, 99 percentage , Iodomethane, 98 percentage , 3 3 4 Dihydroxyphenylacrylic acid 98 percentage , 4 Iodobenzoic acid 97 percentage , Copper I acetate 97 percentage , 6 6 Dimethyl 2 2 bipyridine 98 percentage , 4 4 Dimethyl 2 2 bipyridine 98 percentage , N Pentane 99 percentage , 1 10 Phenanthroline 98 percentage , Hydrogen peroxide 30 percentage , Tert Butyl hydroperoxide, 70 percentage aqueous solution , 4 tert Butylcatechol 98 percentage , Acetonitrile HPLC Grade , 2 Amino 4 6 dimethylpyrimidine , Nicotinic Acid hydrazide , 3 Hydroxy 2 naphthoic Acid Hydrazide , 8 Hydroxyjulolidine 9 carboxaldehyde , Diaminomaleonitrile , 2 hydroxy 3 methoxybenzaldehyde , 1 2 4 Triazole 3 5 diamine , Pyrazinoic acid hydrazide , 3 5 di tert butyl 2 hydroxybenzaldehyde , 2 Hydroxy 1 naphthaldehyde , 3 amino 1 2 4 triazole , 3 Amino 5 methylthio-1H-1 2 4 triazole , 2 2 Dimethyl 1 3 propanediamine , Terephthalaldehyde , 4 aminoazobenzene , 2 Hydrazinyl 4 6 dimethylpyrimidine , Cyclopropanecarbohydrazide , Pivalohydrazide , 2 Thiophenecarboxylic acid hydrazide , 2 Furoic hydrazide , 2 6 Diacetylpyridine , 2 Acetylpyridine , Quinoline 2 carboxaldehyde

Sikkim University Tender Result

Goods
GEM
Result Stage: Awarded  (AOC Available)
East Sikkim, Sikkim
Contract Date30 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 2.4 Lac 
CATEGORY: DEPC Diethyl pyrocarbonate , Rnasezap , PCR master mix Green , Rneasy plant mini Mini Kit 50 , 10x Dnase I reaction buffer , Quantabio qScript cDNA supermix , Quantitech SYBR Green PCR kit 200 , StepUp 250bp DNA Ladder 100 loads 50 microgm , RNA later , DNase I Rnase free , Diluent for DNA Extraction , Jasmonic acid , Formic Acid , nylon syringe filters Polyethersulfone PES Syringe Filters 02 Micron 25mm , Cryo tags , Nitrile gloves , RT PCR plates 96 wells , Microseal Bseal Seals , Autoclavable bags 12 by 24 , Autoclavable bags 14by 19

Sikkim University Tender Result

Goods
GEM
Result Stage: Awarded  (AOC Available)
East Sikkim, Sikkim
Contract Date17 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 3.2 Lac 
CATEGORY: Beaker Glass , Conical Flask Narrow mouth , Culture tubes flat bottom screw cap , Culture Tubes flat bottom screw cap , culture tubes flat bottom screw cap , Measuring Cylinder Glass , Micropippette , Micropippetes , Microtip zero point 2 to 10 microlitre , Microtip 2 to 200 microlitre , Microtip 200 to1000 microlitre , Microtip Box zero point 2 to10 microlitre , Microtip Box 2 to 200 micro litre , Microtip Box 200 to 1000 micro litre , PCR tubes zero point 2ml flat cap , Microcentrifuge tube 1point5ml , Microcentrifuge tube 2ml , cryo vial 100 places , PCR Rack , MicroPippete rack Z type , Test Tube , Test tube , Centrifuge tube conical bottom , Float rack Cryo vial , PCR workstation , HPLC vials amber clear , Microscope slide box , pellet pestles micro pestles , Eppendorf tube rack , pycnometer , Glass rod , instrument sterilizing pan autoclavable , Biohazard waste container , zero degree mini cooler PC with non toxic gel , Gloves nitrile gloves Long cuff Tarson , nitrile gloves Tarson , surgical mask , Magnetic Retriever , Polygon Magnetic Stirrer Bar , Parrafilm M 5cm , motar and pestle , Aluminium Foil , Tissue Paper , Vetroclean , Colour charts for plants , tough tags with station , Autoclavable bag bio hazard

Sikkim University Tender Result

Goods
GEM
Result Stage: Awarded  (AOC Available)
East Sikkim, Sikkim
Contract Date17 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 1.4 Lac 
Forward Acgagctaaagctcattagggtaa Reversetcggcaagaatacaaagtgagtaa,forward Ggatcgttcctttttagggtaat Re

Sikkim University Tender Result

Goods
Chemical Products
GEM
Result Stage: Awarded  (AOC Available)
East Sikkim, Sikkim
Contract Date17 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 4.1 Lac 
CATEGORY: 3 5 Dinitrosalicylic Acid , 6 Benzyl Adenine BAP , Absisic Acid , Acetic Acid Glacial , Adenine Sulphate Dihydrate , Aluminium Standard , Ammonium Dihydrogen Phosphate GR , Ammonium Ferrous Sulphate , Ammonium Monohydrate , Ammonium Persulfate , Ammonium Phosphate Monobasic , Ammonium Sulphate GR , Ammonium thiocyanate , Amylum , Anthrone reagent , Antimony Trichloride , Arsenic Standard , Boric Acid GR Pure , Boron Standard , Bovine Serum Albumin , Bromocresol Green Indicator , Bromophenol Blue , Bromothymol Blue Solution , Butylated Hydroxytoluene , Cadmium Standard , Caffeic acid , Calcium Standard , Carbon Tetrachloride , Cobalt II Chloride heptahydrate , Cobalt Standard , Copper chloride , Cresol Red , Curcumin , Cysteine L Cysteine , D plus Glucose Dextrose monohydrate AR , Disodium Hydrogen Phosphate , Disodium Hydrogen Phosphate Dihydrate , DTPA Diethylenetriamine Penta Acetic Acid , Dinitrosalicylic acid , Diphenylamine AR , Dragendorffs Reagent , EDTA Ferric monosodium Salt , EDTA Disodium salt Dihydrate MB Grade , Ferric Citrate monohydrate , Folic acid , Gallic acid monohydrate , Green Master Mix , Hydrochloric Acid HCl , Indol 3 Butyric Acid , Indole 3 Acetic Acid , Iron II Chloride Tetrahydrate Ferrous Chloride , Iron III Chloride Ferric Chloride , Lead Standard Solution , Magnesium Standard , Methanol hplc grade , Molybdenum Standard , Naphthalene Acetic Acid , Nitroblue tetrazolium chloride , Nitrophenol AR Spectrophotometric grade p nitrophenol , Phenolphthalein Indicator , Potassium Phosphate Monobasic Potassium H2 Orthophosphate , DNA LADDER 1kb , DNA LADDER 100bp , Sodium Hydroxide NaOH , Sodium Hypochlorite Soln , Sodium Phosphate Monobasic Monohydrate , Sodium Phosphate Dibasic Heptahydrate , Sodium Standard , Tetrazolium salt , ICP Multi standard Solution , mordant alum , Teepol , copper sulphate , 2 6 Dicholrophenol , indophenol , potassium thiocynate , ammonium metavanadate , beta carotene , Potassium sodium tartarate , oxalic acid , potassium permanganate , zinc sulphate , citric acid anhydrous , acetone , Acetone molecular grade , sodium carbonate , phenol crystal , Phenopthalin indicator , Plant preservative mixture tissue culture , 2napthoxyacetic acid , picloram , Polyvinylpyrrolidone PVP k30 , benzyl adenine BA , MS Medium 100x1Ltr with cacl2 and vitamins sucrose and agar , thiadiazuron TDZ , 2 4 D plant tissue culture tested , 4 methyl catechol , Ethidium bromide , Nuclease free water , Evans Blue , Trifluroacetic acid TFA HPLC grade , DEAE cellulose HPLC grade , HPLC grade water , sodium phytate , sodium acetate trihydrate , p Nitrophenol , Tris buffer , sodium b glycerolphosphate , Acetonitrile HPLC grade , Ethyl acetate HPLC grade , 0 point2 micrometer membrane filter1 for HPLC , Nylon filter membranes 0 point45 micrometer , Buffer Tablets pH 4 , Buffer Tablets pH 7 , Buffer tablets pH 9 , dendrobin , Safranine , 6X Gel loading buffer , Ammonium Hydrogen phosphate

Sikkim University Tender Result

Goods
GEM
Result Stage: Awarded  (AOC Available)
East Sikkim, Sikkim
Contract Date17 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 1.9 Lac 
CATEGORY: Blotting paper , seive 2mm with frame , Plastic pots nursery pots , Plastic pots , Vermicompost , Green House Uv stablized plastic , muslin cloth , Nursery bags black with holes medium , thermo hygrometer digital RH temperature , Tensiometer , ordinary Rain gauge , Laboratory Apron heavy duty , Foldable telescopic aluminium ladder , nylon brush small , nylon brush large , safety goggles , spray bottle , Anti hail net , Bavistine , Plant label holder T type witn tilted head , Maximum minimum thermometer

Sikkim University Tender Result

Goods
GEM
Result Stage: Potential AOC Released
1 year ago
East Sikkim, Sikkim
Contract Date4 Jan 2024
Contract Amount₹ 33 Lac 
CATEGORY: Desktop , WORKSTATION , Mini Centrifuge , Micro centrifuge , PCR thermal cycler , Gel Imaging System , Electrophoresis Power Supply Unit , minus 40 deep freezer , Portable Electrical Incinerator , NanoSpectrophotometer , Point and shoot bridge camera
81-90 of 158 active Tender Results