Tender Results of Sikkim University
Select Contract Period
2024 onwards
2022 onwards
All Time
Sikkim University Tender Result
Works
Housekeeping Services
Eprocure
Result Stage: Potential AOC Released
East Sikkim, Sikkim
Etender Notice For Various Maintenance Work At The Guest House, Sikkim University
Contract Date15 Jul 2024
Contract Amount₹ 2.8 Lac
This is an estimated amount, exact amount may vary.
Sikkim University Tender Result
Goods
Furnitures and Fixtures
GEM
Result Stage: Potential AOC Released
East Sikkim, Sikkim
CATEGORY: STUDY TABLE , COMPUTER TABLE , CHAIR , Book shelve ,
Insect Growth Chamber
Contract DateNA
Contract Amount₹ 2.6 Lac
Sikkim University Tender Result
Goods
GEM
Result Stage: Under Evaluation
East Sikkim, Sikkim
CATEGORY: Tributyl1-ethoxyvinyl tin , 35 Dibromobenzaldehyde , 5
Methyl 1 10 phenanthroline , Potassium tertiary butoxide ,
NBS , Trifluoromethane Sulfonic Acid , Potassium
tetrachloroaurate iii , Palladium Acetate , 2 Aminopyridine ,
1 10 Phenanthroline , Ethanol amine , Cisteamine
Hydrochloride , 2Methacrylic Acid , 2Aminothiophenol ,
Tetra butyl ammonium perchlorate , N phenylglycine ,
Methylbromide , Dibromomethane , 2 bromoacetylbromide ,
2Bromobenzoic acid , 2Bromo 3 nitrobenzoic acid , 2
Iodobenzoic acid , N N Dimethylaniline , E Buta 13 dien
1ylbenzene , E 3 4 Chlorophenyl acrylaldehyde , E 3 4
Methoxyphenyl acrylaldehyde , Isopropyl Alcohol HPLC
grade , N Hexane HPLCgrade 99percentage ,
Paraformaldehyde , Ethyl bromoacetate , DRY Toluene , N
pentane , Cesium Carbonate , Chloroform D ,
Cinnamaldehyde 3 Phenylacrylaldehyde , 1Bromo 3 fluoro-5
nitrobenzene , 3 Phenylpropanoic acid , 2 3 Benzofuran ,
Methyl acetate , Triglyme , L Glutathione 98percent , methyl
4 iodobenzoate , methyl 1H- indole 6 carboxylate , 5 4
Carboxyphenyl 1 1 3 1 terphenyl 44 dicarboxylic acid
95percentage , 1Methylimidazole 98percentage ,
334Dihydroxyphenyl acrylic acid 98 percentage ,
Polyvinylpyrrolidone k 30 , L Epicatechin , 5 4
Carboxyphenyl 2 methyl 11 3 1 terphenyl 4 4 dicarboxylic
acid 98 percentage , 4 5 Bis 3 carboxyphenyl 1 1 2 1
terphenyl 3 3 dicarboxylic acid 98 percentage , 5 3 5
Dicarboxyphenyl-1 1 3 1 terphenyl 3 3 5 5 tetracarboxylic
acid 98 percentage , L Adrenaline , Methyl indole
3carboxylate 98 percentage , Iron II chloride tetrahydrate ,
4 Dimethylaminopyridine , 55 Dimethyl 1 pyrroline N oxide,
97 percentage , 3355 Tetramethyl 11 biphenyl 4 4 diamine
98 percentage , 5 5 Dimethyl 2 2 bipyridine 98 percentage ,
2 4 Dichlorophenol, 98 percentage , Glucose Oxidase
Aspergillus Niger , 1h Pyrazole 4 carboxylic acid 98 , 2
Nitroimidazole, 99 percentage , Iodomethane, 98
percentage , 3 3 4 Dihydroxyphenylacrylic acid 98
percentage , 4 Iodobenzoic acid 97 percentage , Copper I
acetate 97 percentage , 6 6 Dimethyl 2 2 bipyridine 98
percentage , 4 4 Dimethyl 2 2 bipyridine 98 percentage , N
Pentane 99 percentage , 1 10 Phenanthroline 98 percentage
, Hydrogen peroxide 30 percentage , Tert Butyl
hydroperoxide, 70 percentage aqueous solution , 4 tert
Butylcatechol 98 percentage , Acetonitrile HPLC Grade , 2
Amino 4 6 dimethylpyrimidine , Nicotinic Acid hydrazide , 3
Hydroxy 2 naphthoic Acid Hydrazide , 8 Hydroxyjulolidine 9
carboxaldehyde , Diaminomaleonitrile , 2 hydroxy 3
methoxybenzaldehyde , 1 2 4 Triazole 3 5 diamine ,
Pyrazinoic acid hydrazide , 3 5 di tert butyl 2
hydroxybenzaldehyde , 2 Hydroxy 1 naphthaldehyde , 3
amino 1 2 4 triazole , 3 Amino 5 methylthio-1H-1 2 4 triazole
, 2 2 Dimethyl 1 3 propanediamine , Terephthalaldehyde , 4
aminoazobenzene , 2 Hydrazinyl 4 6 dimethylpyrimidine ,
Cyclopropanecarbohydrazide , Pivalohydrazide , 2
Thiophenecarboxylic acid hydrazide , 2 Furoic hydrazide , 2
6 Diacetylpyridine , 2 Acetylpyridine , Quinoline 2
carboxaldehyde
Contract Date6 Feb 2024
This is an estimated contract date, exact date may vary.
Contract AmountRefer Documents
Sikkim University Tender Result
Goods
GEM
Result Stage: Awarded (AOC Available)
East Sikkim, Sikkim
CATEGORY: DEPC Diethyl pyrocarbonate , Rnasezap , PCR master mix
Green , Rneasy plant mini Mini Kit 50 , 10x Dnase I reaction
buffer , Quantabio qScript cDNA supermix , Quantitech
SYBR Green PCR kit 200 , StepUp 250bp DNA Ladder 100
loads 50 microgm , RNA later , DNase I Rnase free , Diluent
for DNA Extraction , Jasmonic acid , Formic Acid , nylon
syringe filters Polyethersulfone PES Syringe Filters 02 Micron
25mm , Cryo tags , Nitrile gloves , RT PCR plates 96 wells ,
Microseal Bseal Seals , Autoclavable bags 12 by 24 ,
Autoclavable bags 14by 19
Contract Date30 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 2.4 Lac
Sikkim University Tender Result
Goods
GEM
Result Stage: Awarded (AOC Available)
East Sikkim, Sikkim
CATEGORY: Beaker Glass , Conical Flask Narrow mouth , Culture tubes
flat bottom screw cap , Culture Tubes flat bottom screw cap
, culture tubes flat bottom screw cap , Measuring Cylinder
Glass , Micropippette , Micropippetes , Microtip zero point 2
to 10 microlitre , Microtip 2 to 200 microlitre , Microtip 200
to1000 microlitre , Microtip Box zero point 2 to10 microlitre ,
Microtip Box 2 to 200 micro litre , Microtip Box 200 to 1000
micro litre , PCR tubes zero point 2ml flat cap ,
Microcentrifuge tube 1point5ml , Microcentrifuge tube 2ml ,
cryo vial 100 places , PCR Rack , MicroPippete rack Z type ,
Test Tube , Test tube , Centrifuge tube conical bottom ,
Float rack Cryo vial , PCR workstation , HPLC vials amber
clear , Microscope slide box , pellet pestles micro pestles ,
Eppendorf tube rack , pycnometer , Glass rod , instrument
sterilizing pan autoclavable , Biohazard waste container ,
zero degree mini cooler PC with non toxic gel , Gloves nitrile
gloves Long cuff Tarson , nitrile gloves Tarson , surgical
mask , Magnetic Retriever , Polygon Magnetic Stirrer Bar ,
Parrafilm M 5cm , motar and pestle , Aluminium Foil , Tissue
Paper , Vetroclean , Colour charts for plants , tough tags
with station , Autoclavable bag bio hazard
Contract Date17 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 3.2 Lac
Sikkim University Tender Result
Goods
GEM
Result Stage: Awarded (AOC Available)
East Sikkim, Sikkim
Forward Acgagctaaagctcattagggtaa Reversetcggcaagaatacaaagtgagtaa,forward Ggatcgttcctttttagggtaat Re
Contract Date17 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 1.4 Lac
Sikkim University Tender Result
Goods
Chemical Products
GEM
Result Stage: Awarded (AOC Available)
East Sikkim, Sikkim
CATEGORY: 3 5 Dinitrosalicylic Acid , 6 Benzyl Adenine BAP , Absisic
Acid , Acetic Acid Glacial , Adenine Sulphate Dihydrate ,
Aluminium Standard , Ammonium Dihydrogen Phosphate
GR , Ammonium Ferrous Sulphate , Ammonium
Monohydrate , Ammonium Persulfate , Ammonium
Phosphate Monobasic , Ammonium Sulphate GR ,
Ammonium thiocyanate , Amylum , Anthrone reagent ,
Antimony Trichloride , Arsenic Standard , Boric Acid GR Pure
, Boron Standard , Bovine Serum Albumin , Bromocresol
Green Indicator , Bromophenol Blue , Bromothymol Blue
Solution , Butylated Hydroxytoluene , Cadmium Standard ,
Caffeic acid , Calcium Standard , Carbon Tetrachloride ,
Cobalt II Chloride heptahydrate , Cobalt Standard , Copper
chloride , Cresol Red , Curcumin , Cysteine L Cysteine , D
plus Glucose Dextrose monohydrate AR , Disodium
Hydrogen Phosphate , Disodium Hydrogen Phosphate
Dihydrate , DTPA Diethylenetriamine Penta Acetic Acid ,
Dinitrosalicylic acid , Diphenylamine AR , Dragendorffs
Reagent , EDTA Ferric monosodium Salt , EDTA Disodium
salt Dihydrate MB Grade , Ferric Citrate monohydrate , Folic
acid , Gallic acid monohydrate , Green Master Mix ,
Hydrochloric Acid HCl , Indol 3 Butyric Acid , Indole 3 Acetic
Acid , Iron II Chloride Tetrahydrate Ferrous Chloride , Iron III
Chloride Ferric Chloride , Lead Standard Solution ,
Magnesium Standard , Methanol hplc grade , Molybdenum
Standard , Naphthalene Acetic Acid , Nitroblue tetrazolium
chloride , Nitrophenol AR Spectrophotometric grade p
nitrophenol , Phenolphthalein Indicator , Potassium
Phosphate Monobasic Potassium H2 Orthophosphate , DNA
LADDER 1kb , DNA LADDER 100bp , Sodium Hydroxide
NaOH , Sodium Hypochlorite Soln , Sodium Phosphate
Monobasic Monohydrate , Sodium Phosphate Dibasic
Heptahydrate , Sodium Standard , Tetrazolium salt , ICP
Multi standard Solution , mordant alum , Teepol , copper
sulphate , 2 6 Dicholrophenol , indophenol , potassium
thiocynate , ammonium metavanadate , beta carotene ,
Potassium sodium tartarate , oxalic acid , potassium
permanganate , zinc sulphate , citric acid anhydrous ,
acetone , Acetone molecular grade , sodium carbonate ,
phenol crystal , Phenopthalin indicator , Plant preservative
mixture tissue culture , 2napthoxyacetic acid , picloram ,
Polyvinylpyrrolidone PVP k30 , benzyl adenine BA , MS
Medium 100x1Ltr with cacl2 and vitamins sucrose and agar
, thiadiazuron TDZ , 2 4 D plant tissue culture tested , 4
methyl catechol , Ethidium bromide , Nuclease free water ,
Evans Blue , Trifluroacetic acid TFA HPLC grade , DEAE
cellulose HPLC grade , HPLC grade water , sodium phytate ,
sodium acetate trihydrate , p Nitrophenol , Tris buffer ,
sodium b glycerolphosphate , Acetonitrile HPLC grade ,
Ethyl acetate HPLC grade , 0 point2 micrometer membrane
filter1 for HPLC , Nylon filter membranes 0 point45
micrometer , Buffer Tablets pH 4 , Buffer Tablets pH 7 ,
Buffer tablets pH 9 , dendrobin , Safranine , 6X Gel loading
buffer , Ammonium Hydrogen phosphate
Contract Date17 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 4.1 Lac
Sikkim University Tender Result
Goods
GEM
Result Stage: Awarded (AOC Available)
East Sikkim, Sikkim
CATEGORY: Blotting paper , seive 2mm with frame , Plastic pots nursery
pots , Plastic pots , Vermicompost , Green House Uv
stablized plastic , muslin cloth , Nursery bags black with
holes medium , thermo hygrometer digital RH temperature ,
Tensiometer , ordinary Rain gauge , Laboratory Apron heavy
duty , Foldable telescopic aluminium ladder , nylon brush
small , nylon brush large , safety goggles , spray bottle ,
Anti hail net , Bavistine , Plant label holder T type witn tilted
head , Maximum minimum thermometer
Contract Date17 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 1.9 Lac
Sikkim University Tender Result
Goods
GEM
Result Stage: Potential AOC Released
East Sikkim, Sikkim
CATEGORY: Desktop , WORKSTATION , Mini Centrifuge , Micro centrifuge
, PCR thermal cycler , Gel Imaging System , Electrophoresis
Power Supply Unit , minus 40 deep freezer , Portable
Electrical Incinerator , NanoSpectrophotometer , Point and
shoot bridge camera
Contract Date4 Jan 2024
Contract Amount₹ 33 Lac
Sikkim University Tender Result
Goods
GEM
Result Stage: Potential AOC Released
East Sikkim, Sikkim
CATEGORY: Mercury thermometer , Dissection box , Stool sample
collection container , pH paper 6.5-12 , Tough Tags , Pre
coated poly lycin Charged Slides , Animal Handling gloves
Bite proof , Butterfly needle , Clear Flat-Bottom Immuno
Nonsterile 96-Well Plates , Oral feeding needle 18G for rats ,
Medical Student Dissection Kit , Bd Insulin Syringe , Glass
conical bottom 10 ml graduated test-tube , Falcon snake
rescue bag , LED head lamp , mini extensible Snake hook ,
rechargable Li-Ion camera battery , High Powered LED
flashlight , Container 250 ml , Container 500ml , Container
1000 ml , Container 5Ltr , Bosch GLM 40 Laser distance ,
Aquarium , SD Card , Harddrive , Rescholar Insect collecting
net , Rescholar Zooplankton net , Insect Box with Stretching
Strips , Measuring tape , entomolgical pins , glassine
envelops , Entomological Brush , Insect Killing Jars , Cavity
Slides or Well Slides , Stage micrometer , Entomological
forceps Set of 5 , Bohemia Insect Pins , Bait trap , Plastic
Genitalia Vials , Plastic Rice Keeper , nitrile gloves ,
Lepidtarium , Insect Rearing Cage , Butterfly Net , pH meter
, Butterfly glassine envelopes bags 45 85mm , T75 cell
culture flask , Serological pipette , Pipette pump , Freezing
container , Cryogenic tubes , Corning syringe filters , Nylon
Polypropylene Dmso-Safe Syringe Filter, For Laboratory,
25mm , Flat bottomed 96-well microtiter plate , Clear 96-
well flat-bottom plate for elisa reader , Blood collection
tubes clot activator , Amicon Ultra-15 Centrifugal Filters
Ultracel 3K , Cello 20L picnic ice packs cooling box ,
Variable Volume Pipette , Micro Tips , Macro Tips , PCR tubes
, Centrifuge Tubes , Volumetric flask , Conical Flask , watch
glass , Petri Dishes , Amber reagent bottles , Cover slip ,
Measuring Cylinder , Burette , Magnifying Lens ,
Haemocytometer silver coated for RBC counting ,
Haemocytometer silver coated for WBC counting , Carboy
with stooper , WIDE MOUTH BOTTLE , Reagent bottle with
stoper AMBER , Reagent bottle with stoper , cotton ,
Handwash , antiseptic Liquid , aluminuium foil ,
CENTRIGUGE TUBE , REVERSIBLE RACK , MICROTUBE ICE
RACK , MICROPESTLE , parfilm , tissue roll
Contract Date26 Dec 2023
Contract Amount₹ 7.7 Lac
81-90 of 157 active Tender Results