Punjab Tenders

Punjab Tenders

... More
If you want to inquire about any e-tender the Punjab government has posted, Bidassist gives a one-stop solution i.e. being a registered bidder you will find every eprocurement Punjab tender on BidAssist.There is no need to enter all the details on the website of etender.up.nic.in as BidAssist helps you find the specific Punjab etender you're looking for. Read further to learn how to search and bid for etender Punjab.

Rail Coach Factory - RCF Tender

Goods
Healthcare and Medicine
GEM
Corrigendum : Closing Date Modified
Kapurthala, Punjab
Closing Soon28 Feb 2025
Tender AmountRefer Documents 
CATEGORY: Itraconazole Capsule (Q2)

Panjab University - PU Tender

Goods
Healthcare and Medicine
GEM
Chandigarh, Punjab
Closing Soon24 Feb 2025
Tender AmountRefer Documents 
CATEGORY: Magneto therapy , Magneto therapy High Power Laser Therapy Device Unit , Combination Therapy Unit Ultrasound AND Electrotherapy with Vaccum , Unit Short Wave Diathermy , Cryo therapy Unit

National Institute Of Pharmaceutical Education And Research - NIPER Tender

Goods
Healthcare and Medicine
GEM
S.a.s Nagar, Punjab
Closing Soon24 Feb 2025
Tender AmountRefer Documents 
CATEGORY: FAM labelled miRNA let 7b 5p mimic (hsa let 7b 5p) Mature miRNA Sequence UGAGGUAGUAGGUUGUGUGGUU, 100 , miRNA let 7b 5p inhibitor Mature miRNA Sequence UGAGGUAGUAGGUUGUGUGGUU, 100 nm , miRNA let 7b 5p mimic (hsa let 7b 5p) Mature miRNA Sequence UGAGGUAGUAGGUUGUGUGGUU, 100 nm

National Institute Of Pharmaceutical Education And Research - NIPER Tender

Goods
Healthcare and Medicine...+1Chemical Products
GEM
S.a.s Nagar, Punjab
Closing Soon22 Feb 2025
Tender AmountRefer Documents 
Disinfectant 5 Litre

All India Institute Of Medical Sciences Tender

Goods
Healthcare and Medicine
GEM
Bathinda, Punjab
Closing Soon22 Feb 2025
Tender AmountRefer Documents 
CATEGORY: Digital Medical X - Ray Films (V2) (Q2)

Department Of Animal Husbandry Dairying And Fisheries Tender

Healthcare and Medicine
GEM
Corrigendum : Closing Date Modified
S.a.s Nagar, Punjab
Closing Soon28 Feb 2025
Tender AmountRefer Documents 
CATEGORY: Veterinary Ultrasound Machine (V2) (Q2)

Bhakra Beas Management Board - BBMB Tender

Goods
Healthcare and Medicine...+1Chemical Products
GEM
Corrigendum : Closing Date Modified
Rupnagar, Punjab
Closing Soon26 Feb 2025
Tender AmountRefer Documents 
CATEGORY: Disinfectant Fluids , Phenolic Type (V3) conforming to IS 1061 (Q3)

Department Of Animal Husbandry Dairying And Fisheries Tender

Healthcare and Medicine
GEM
Corrigendum : Closing Date Modified
S.a.s Nagar, Punjab
Closing Soon28 Feb 2025
Tender AmountRefer Documents 
CATEGORY: Digital Radiography System (V2) (Q2)

Punjab Health System Corporation - PHSC Tender

Goods
Healthcare and Medicine
Eprocure
Corrigendum : Closing Date Modified
S.a.s Nagar, Punjab
Closing Soon28 Feb 2025
Tender AmountRefer Documents 
Procurement Of Hospital Consumables Items

Punjab Health System Corporation - PHSC Tender

Goods
Healthcare and Medicine
Eprocure
Corrigendum : Closing Date Modified
S.a.s Nagar, Punjab
Closing Soon24 Feb 2025
Tender AmountRefer Documents 
Equipment/items And Instruments For Bls Ambulances
231-240 of 248 active Tenders