Punjab Tenders
Punjab Tenders
... More
If you want to inquire about any e-tender the Punjab government has posted, Bidassist gives a one-stop solution i.e. being a registered bidder you will find every eprocurement Punjab tender on BidAssist.There is no need to enter all the details on the website of etender.up.nic.in as BidAssist helps you find the specific Punjab etender you're looking for. Read further to learn how to search and bid for etender Punjab.
Rail Coach Factory - RCF Tender
Healthcare and Medicine
GEM
Kapurthala, Punjab
Closing Soon28 Feb 2025
Tender AmountRefer Documents
CATEGORY: Itraconazole Capsule (Q2)
Panjab University - PU Tender
Healthcare and Medicine
GEM
Chandigarh, Punjab
Closing Soon24 Feb 2025
Tender AmountRefer Documents
CATEGORY: Magneto therapy , Magneto therapy High Power Laser
Therapy Device Unit , Combination Therapy Unit Ultrasound
AND Electrotherapy with Vaccum , Unit Short Wave
Diathermy , Cryo therapy Unit
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Healthcare and Medicine
GEM
S.a.s Nagar, Punjab
Closing Soon24 Feb 2025
Tender AmountRefer Documents
CATEGORY: FAM labelled miRNA let 7b 5p mimic (hsa let 7b 5p) Mature
miRNA Sequence UGAGGUAGUAGGUUGUGUGGUU, 100 ,
miRNA let 7b 5p inhibitor Mature miRNA Sequence
UGAGGUAGUAGGUUGUGUGGUU, 100 nm , miRNA let 7b 5p
mimic (hsa let 7b 5p) Mature miRNA Sequence
UGAGGUAGUAGGUUGUGUGGUU, 100 nm
National Institute Of Pharmaceutical Education And Research - NIPER Tender
Healthcare and Medicine...+1Chemical Products
GEM
S.a.s Nagar, Punjab
Closing Soon22 Feb 2025
Tender AmountRefer Documents
Disinfectant 5 Litre
All India Institute Of Medical Sciences Tender
Healthcare and Medicine
GEM
Bathinda, Punjab
Closing Soon22 Feb 2025
Tender AmountRefer Documents
CATEGORY: Digital Medical X - Ray Films (V2) (Q2)
Department Of Animal Husbandry Dairying And Fisheries Tender
Healthcare and Medicine
GEM
S.a.s Nagar, Punjab
Closing Soon28 Feb 2025
Tender AmountRefer Documents
CATEGORY: Veterinary Ultrasound Machine (V2) (Q2)
Bhakra Beas Management Board - BBMB Tender
Healthcare and Medicine...+1Chemical Products
GEM
Rupnagar, Punjab
Closing Soon26 Feb 2025
Tender AmountRefer Documents
CATEGORY: Disinfectant Fluids , Phenolic Type (V3) conforming to IS
1061 (Q3)
Department Of Animal Husbandry Dairying And Fisheries Tender
Healthcare and Medicine
GEM
S.a.s Nagar, Punjab
Closing Soon28 Feb 2025
Tender AmountRefer Documents
CATEGORY: Digital Radiography System (V2) (Q2)
Punjab Health System Corporation - PHSC Tender
Healthcare and Medicine
Eprocure
S.a.s Nagar, Punjab
Closing Soon28 Feb 2025
Tender AmountRefer Documents
Procurement Of Hospital Consumables Items
Punjab Health System Corporation - PHSC Tender
Healthcare and Medicine
Eprocure
S.a.s Nagar, Punjab
Closing Soon24 Feb 2025
Tender AmountRefer Documents
Equipment/items And Instruments For Bls Ambulances
231-240 of 248 active Tenders
Tenders By Categories
Civil & Construction Tenders in Punjab
Electrical & Electronics Tenders in Punjab
Machinery & Tools Tenders in Punjab
Civil Works Others Tenders in Punjab
Healthcare & Medicine Tenders in Punjab
Automobiles & Auto Parts Tenders in Punjab
Electrical Goods & Equipments Tenders in Punjab
Building Construction Tenders in Punjab
Food Products Tenders in Punjab
Electronics Equipment Tenders in Punjab
Show MoreTenders By Authorities
Indian Army Tenders in Punjab
Punjab Mandi Board Tenders in Punjab
Department Of Local Government Tenders in Punjab
Water Resources Department Tenders in Punjab
Northern Railway Tenders in Punjab
Rail Coach Factory Tenders in Punjab
Military Engineer Services Tenders in Punjab
Public Works Department Tenders in Punjab
Indian Air Force Tenders in Punjab
Patiala Locomotive Works Tenders in Punjab
Show More