Filters & Sort
  1. Home/
  2. Indian Tenders/
  3. Himachal Pradesh Tenders/
  4. Shimla Tenders/
  5. Active Tenders
Reset All
Himachal Pradesh
Shimla
Shimla Tenders

Shimla Tenders

... More
Bidassist allows us to explore new opportunities across the whole world so as to support the growth of the business. It is designed in such a manner that if we need any kind of information about any government e-tender the Himachal Pradesh government has posted on its website, Bidassist provides the same in a very hassle-free manner. As BidAssist is designed as a very user-friendly website which helps us find the specific Himachal Pradesh etender we are looking for.

Elementary Education Department Tender

Goods
Aerospace and Defence
GEM
Shimla, Himachal Pradesh
Closing Soon23 Nov 2024
Tender AmountRefer Documents 
Package No. 1 - Atal Tinkering Lab Of Niti Aayog Electronics Development, Robotics, Internet Of Th

Public Works Department - PWD Tender

Works
Eprocure
Shimla, Himachal Pradesh
Closing Date28 Nov 2024
Tender Amount₹ 5.5 Lac 
Amc Of 1 No. Passenger Cum Bed Elevators Installed In Kamla Nehru State Hospital For Mother And Child At B Block Shimla For The Period Of 3 Years.

Indian Council Of Agricultural Research - ICAR Tender

Goods
GEM
Shimla, Himachal Pradesh
Closing Date30 Nov 2024
Tender AmountRefer Documents 
CATEGORY: Alt-R-CRISPR-Cas9 sgRNA , Alt-CRISPR-Cas9crRNA(FLA_ gl: CTAGGAGGTGAATCTCTCGT , Alt-RCRISPR-Cas9crRNA(FLA_ g2: TTAGAGGTGTCACGAAA CTA) , Alt-R CRISPR-Cas9 crRNA (FLA_ g3: ATAACGATACAGTTGCAAGT) , Alt-R CRISPR_ Cas9 crRNA (DVT_ Gl: TCTGTTGGTGAAGAAAATGC) , Alt-R CRISPR- Cas9 crRNA(DVT_ g2: ATAATCTAACCCCTGCAGAG) , Alt-R CRISPR-Cas9 crRNA(DVT_ g3: TATGTAGCGCCTCTCTGCAG) , Alt-R CRISPR-Cas9 crRNA XT , Alt-R CRISPR-Cas9 sgRNA , Alt-R CRISPR-Cas9 Tracr RNA , Alt-R S. p. HiFi-Cas9 Nuclease V3 , Nuclease Free Duplex Buffer , Nuclease Free Duplex Buffer (10x2ml) , IDTE(1XTE Solution) , IDTE(1X TE Solution; 10x2ml)

Municipal Corporation Tender

Works
Civil And Construction...+1Road Construction
Eprocure
Corrigendum : Closing Date Modified
Shimla, Himachal Pradesh
Closing Soon23 Nov 2024
Tender Amount₹ 8.9 Lac 
Mc Road From Ag Chowk To Advance Study In Ward No 4 Annandale R D 3 615 To 5 465 (sh Kerb Stone Drain Etc Rd 5 165 To 5 465)

Indian Army Tender

Goods
GEM
Corrigendum : Closing Date Modified
Shimla, Himachal Pradesh
Closing Soon19 Nov 2024
Tender AmountRefer Documents 
CATEGORY: Plastic Tarpulin , Belcha , Agro Net 50 Mtr , Tasla Plastic , Portable Toilet , Daru Seed , Devdar Seeds

Satluj Jal Vidyut Nigam Limited - SJVN Tender

Goods
Electrical Goods and Equipments...+1Electrical and Electronics
GEM
Shimla, Himachal Pradesh
Closing Date28 Nov 2024
Tender Amount₹ 1.4 Lac 
Convection Heaters - Room Heater, Blower,convection Heaters - Room Heater, Blower,convection Heater

Satluj Jal Vidyut Nigam Limited - SJVN Tender

Works
Energy, Oil and Gas...+1Solar Installation and Products
Corrigendum : Closing Date Modified
Shimla, Himachal Pradesh
Closing Soon20 Nov 2024
Tender Amount₹ 2 Cr 
Epc Package With Land For Development Of Ac Grid Connected Solar Photovoltaic Power Projects

Satluj Jal Vidyut Nigam Limited - SJVN Tender

Goods
GEM
Shimla, Himachal Pradesh
Closing Soon18 Nov 2024
Tender Amount₹ 75 K 
Steel Channels And Hot Rolled Steel Section (in Metric Tonne) As Per Is 808

Indian Army Tender

Goods
Electronics Equipment...+2Furnitures and Fixtures, Electrical and Electronics
GEM
Shimla, Himachal Pradesh
Closing Date3 Dec 2024
Tender AmountRefer Documents 
CATEGORY: Heater patio , Paper shredder , Tv 32 inch , Tv 43 inch , TV 55 inch , Tv 65 inch , Chairs

Central Public Works Department - CPWD Tender

Electrical Works...+1Electrical and Electronics
Shimla, Himachal Pradesh
Closing Soon19 Nov 2024
Tender Amount₹ 1.7 Lac 
M/r To Dpra Under Lower Summer Hill Shimla During 2024-25. (sh:- Providing And Fixing Of Wiring, Fittings And 2x2 Led Fittings For Gym At Command House Shimla).
211-220 of 335 active Tenders

About Himachal Pradesh

Himachal Pradesh is the northernmost state of India which is situated in the Western Himalayas. It shares borders with Punjab to the west, Haryana to the southwest, Uttarakhand to the southeast and a very narrow border with Uttar Pradesh to the south. Also, it shares an international border to the east with the Tibet Autonomous Region in China. Himachal Pradesh is also known as Dev Bhoomi, which means 'Land of Gods' and Veer Bhoomi which means 'Land of the Brave'. On 18 December 1970, the State of Himachal Pradesh Act was passed by the Parliament, and a new state came into existence on 25 January 1971. Shimla is declared to be the summer capital of Himachal Pradesh and Dharamshala to be the winter capital of Himachal Pradesh. It covers an area of 55673 km2 (21495 sq mi). As of 2018, Himachal is the 22nd-largest state economy in India having ₹1.52 lakh crore (US$19 billion) in gross domestic product and also it has the 13th-highest per capita income (₹160,000 (US$2,000)) among the states and union territories of India.

About BidAssist


Bidassist is a very unique online platform that helps us to acquire any kind of latest information, updates etc. of all e-tenders at a single location. We can easily explore anything about all the public and government tenders.
It provides us more than 8-level filtration with the help of which we can experience a seamless user experience. Also, these filters help us to sort the e-tenders according to the issuing authority, category, state, city, etc. We can look for all the latest active tenders at one place by just typing Himachal Pradesh on the website of Bidassist.
So, this make looking for a specific tender from the vast pool of information easier. Be it an e-tender for Himachal Pradesh Public Works Department (PWD) or Agriculture department, one can easily find a list of all the tenders released by any government department.
For any query related to Himachal Pradesh tenders, you can reach the BidAssist customer care centre at 1800 102 9586.



How to view Himachal Pradesh tenders on BidAssist

Step 1: Log in to BidAssist
  • Visit the BidAssist website with the help of your laptop or mobile.

  • Select the tab "Sign In" at the top-right corner of the page.

  • Enter your 10-digit mobile number and OTP received on your mobile number for logging in successfully.

    • Step 2: Search the Himachal Pradesh tender opportunities by entering related keyword, e.g. Himachal Pradesh e-tender or etenders in Himachal Pradesh, etc.
    By availing the BidAssist plan, we can easily view and download the details of all the active tenders. For that, we just need to type the name or category of the tender in the search box. It also provides a list of every issued e-tender Himachal Pradesh in the "Archived" section even those which are now closed.
    Step 3: Download documents & follow UP e-tender
    By following the tender for which the documents have been downloaded, it enables us to stay updated with further updates if any. Also, we can receive all the important information in our email

    FAQs about Himachal Pradesh Tenders

    1. What is the customer support regarding Tenders Portal ?
    For tender related queries, you need to get in touch with the Tender Inviting Authority through eMail ID provided in the tender. For system related technical doubts please feel free to call on 24x7 Help line at 0120-4200462, 0120-4001002, +91-8826246593
    2. What is the maximum size of a bid document on the eProcurement portal?
    There is no such restriction on the size of bid documents that can be uploaded on the portal. However, the upload limit is decided by the Network speed that the client system has and also the memory configurations that have been defined in the system for JRE. The technical documentation is provided in Technical Resources on the Home Page.
    3. How to check the latest Himachal Pradesh tenders online?
    Go to the official website of https://hptenders.gov.in -> https://hptenders.gov.inand under the tab of "Latest Tenders", you would be able to see up to 10 latest tenders scrolling in the section. If you wish to check for a specific tender and have an ID for it, click on the "More" link.
    Combined ShapeCreated with Sketch.Sign In
    TENDER BY COUNTRIES
    View All
    United States Tenders|
    United Kingdom Tenders|
    Spain Tenders|
    France Tenders|
    Qatar Tenders|
    Australia Tenders|
    Canada Tenders|
    China Tenders|
    Malaysia Tenders|
    Maldives Tenders|
    Singapore Tenders|
    Bangladesh Tenders|
    Ethiopia Tenders|
    Bhutan Tenders|
    Kuwait Tenders|
    Oman Tenders|
    Germany Tenders|
    Egypt Tenders|
    Ghana Tenders|
    Saudi Arabia Tenders
    TENDER BY AUTHORITIES
    View All
    Federal Road Agency Tenders|
    Bangladesh Railway Tenders|
    Area Metropolitana De Barcelona Tenders|
    Jsc Russian Railways Tenders|
    Kuwait Oil Company Tenders|
    Civil Aviation Authority Tenders|
    Food And Agriculture Org. Tenders|
    Eskom Tenders|
    Energy Regulation Commision Tenders|
    Dept Of Defence Tenders
    TENDER BY CATEGORIES
    View All
    Agriculture Or Forestry Works Tenders|
    Automobiles And Auto Parts Tenders|
    Civil And Construction Tenders|
    Consultancy Services Tenders|
    Education And Training Services Tenders|
    Electrical And Electronics Tenders|
    Finance And Insurance Sectors Tenders|
    Food Products Tenders|
    Furnitures And Fixtures Tenders|
    Healthcare And Medicine Tenders
    TENDER BY PROCUREMENT
    Goods Tenders|
    Works Tenders|
    Services Tenders
    OFG MANUFACTURING BUSINESSES PRIVATE LIMITED
    • Head Office
      6th Floor, Global Business Park, Tower A, Besides Guru Dronacharya Metro Station, Gurugram, Haryana - 122002, India
    • Sales Office
      B - 705 & 706, Sankalp Iconic Tower, Opp. Vikramnagar Colony, Iscon Cross Road, S. G. Highway, Ahmedabad - 380054, India
    COMPANY
    POLICIES
    SUPPORT
    MOBILE APPS
    © Powered by OFG MANUFACTURING BUSINESSES PRIVATE LIMITED, All Rights Reserved