Tender Results of Indian Council Of Medical Research

CATEGORY: 4448892 SOD2 Taqman Probe, FAM labelled 75 rxn , 4453320 Gpx1 Taqman Probe, FAM labelled 75 rxn , E-EL- R3022 Rat Anti-mullerian hormone AMH ELISA plate- 96 well , E-EL-R0391 Rat Follicle stimulating hormone FSH ELISA plate- 96 well , E-EL-R0026 Rat Luteinizing hormone LH ELISA plate-96 well , E-OSEL-R0001 Rat Estradiol E2 hormone ELISA plate-96 well , H-1700 Antifade Mounting Medium 10 ml , 4453320 Mm00446095 m1 Toll like receptor 1 Primer 75 rxn , 4453320 Mm00442346_m1 Toll- like receptor 2 Primer 75 rxn , 4453320 Mm01207404_m1 Toll-like receptor 3 Primer 75 rxn , 4453320 Mm00445273_m1 Toll-like receptor 4 Primer 75 rxn , 4453320 Mm00546288_s1 Toll-like receptor 5 Primer 75 rnx , 4453320 Mm02529782_s1 Toll-like receptor 6 Primer 75 rnx , 4453320 Mm00446590_m1 Toll-like receptor 7 Primer 75 rnx , 4453320 Mm01157262_m1 Toll-like receptor 8 Primer 75 rnx , 4453320 Mm00446193_m1 Toll-like receptor 9 Primer 75 rnx , 4453320 Mm99999915_g1 GAPDH 75 rnx , HPA030522 Anti-PCNA 100 ul , HMG-1 H4652-.1MG human recombinant protein 1 mg , C5894-50MG Collagenase type IA 50 mg , 04906837001 PhosSTOP phosphatase inhibitor cocktail tablets 20 tablets , DAL1025 AlamarBlue and alamarBlue HS Cell Viability Reagents , 30164033 HMGB1 ELISA kit IBL International 96 wells

CATEGORY: Manpower Outsourcing Services - Fixed Remuneration - Healthcare; Research Scientist; As per buyer uploaded ATC document , Manpower Outsourcing Services - Fixed Remuneration - Healthcare; Lab. Technician; As per buyer uploaded ATC document , Manpower Outsourcing Services - Fixed Remuneration - Healthcare; Staff Nurses; As per buyer uploaded ATC document

CATEGORY: Cell scrappers, sterile Disposable , Sterile Disposable serological pipettes 5ml , Sterile Disposable serological pipettes 10ml , Antibiotic antimycotic 100ml , Minimum essential media eagles,s with hanks salt 500ml , Tissue culture flask, sterile treated, T25 vented , Tissue culture flask, sterile treated, T25 Plug seal cap , Tissue culture flask, sterile treated, T75 vented , Tissue culture flask, sterile treated, T75 Plug seal cap , Permanent markers black, Lumo fine permanent , DMEM 500ml , FBS 500ml , Storage bottles 150ml , Storage bottles 250 ml , Glutamax 100ml , Non essential amino acid 100ml , DMEM Powder 10x1L , Ethanol 500ml , Heat inactivated FBS 500ml , Crystal violet stain 25g , Formaldehyde 1L , Biohazard bags 8 x 12 , Labelling tape Medium , Minimum essential media, MEM,500ml , Immersion oil, High viscosity 125ml , Dextrose 500g , Nacl sodium chloride 500g , Diethyl ether 500ml , Chloroform 500ml , Tips 10ul without filter , Tips 200ul without filter , Borosil glass bottles 500ml,Brown , 1X Flow cell wash kit, Exp WSH004 , 16S barcoding kit 24V14,SQK 16S114point24 , LongAmpr Hot start Taq 2x mastermix 100Rxn , Cryo labels 1 x 0point5 1000perpk , Mini ice bucket 1L 2perpack , Magnetic stand 1point5 to 2ml for 16 wells , Micro cover glasses, size 18mm circular, thickness no 1, 0point13mm to 0point16mm thick, 20packet per Box , Dneasy Blood and tissue kit, 250

CATEGORY: Stat1 Py701 Alexa 647 4a , CD14 PE RMO52 , Anti S6 pS235 by pS236 V450 BD Phosflow 561457 N7 548 , AKT pS473 PE BD Phosflow 560378 , Hu Granzyme B FITC GB11 , Hu Perforin PE Set dG9 , Hu CD15 APC HI98 BD Bioscience , PURIFIED NA by LE MOUSE ANTI HUMAN CD3 CLONE OKT3 , Ultra leaf purified anti human CD28 Clone Cd28 2 Mouse IgG1 , IntraPrep Permeabilizaton Reagent

CATEGORY: FITC anti human IgD Antibody IA6 2 348206 100tests , TCRgd PC7 , CD3 APC UCHT1 1 Ml ASR , 560178 BD CD45 2D1 APC H7 , PerCP by Cyanine5 5 anti human IgM Antibody BIOLEGEND , Hu CD38 BV605 HB7 100 Tst , Hu CD15 PerCP Cy5 5 HI98 , Hu CD157 PE SY by 11B5 , Hu CD107a FITC H4A3 , CD56 APC NCAM16 2

CATEGORY: HUMAN IL 2 ANIMAL FREE RECOMBINANT PROTEIN PEPROTECH 10 UG , HUMAN IL 7 ANIMAL FREE RECOMBINANT PROTEIN PEPROTECH 10 UG , Anti K Big Immucor , Anti k small Immucor , Anti Leb mono Immucor , Anti Lea mono Immucor , Anti Fya Immucor , Anti S Fyb Immucor

CATEGORY: Anti C Big Immucor , Anti c small Immucor , Anti E Big Immucor , Anti e small Immucor , Anti M Mono Immucor , Anti N mono Immucor , Anti S Big Immucor , Anti Jka Immucor , Anti Jkb Immucor , Anti s small Immucor

CATEGORY: Pentonic Ball Pen Blue Pack of 10 A , Clear sheet protector A by 4 size thickness 200 A , Clear sheet protector A by 4 size thickness 200 B , Clear sheet protector A by 4 size thickness 200 C , Pentonic Ball Pen Blue Pack of 10 B

CATEGORY: HBE.CE HbeAg or Ab Diapro Diagnostics -96wells , BCM.CE HBC IgM ELISA Kit Diapro -96 wells , BCAB.CE HBc Elisa Kit Diapro -96T , SAB.CE HBsAb Elisa Kit Diapro -96 wells , Benesphera HBsAg Advanced ELISA -Make Avantor- BENP15001007 , PathoDetect HBV Quantitative PCR KIT 50 rxn including extraction kit cat. PHBVQ50 HSN- 30021099 , Pathodetect HCV RNA PCR Kit alongwith extraction kit -50 rxns , ZR DNA Sequencing Clean-up KitTM -200 Preps with Zymo Spin IB , Meril Meriscreen HBsAg test Kit , nuclease free water 500ml 112450204 , Formaldehyde Solution LR 500ml , Potassium Parmanganate LR 500gm , Dulbeccosi s PBS 1X without Mg and Ca , PrimeScript 1st strand cDNA Synthesis kit -TAKARA 50Rxns per kit Cat no 6110A , DFS Taq DNA Polymerase 500units- Bioron , ALERE DETERMINE HIV1 by 2 , INNOLIA LIA HIV I or II SCORE 28672 Kit Cat No 80540 , GEN-MT-175C-1.75 MICROTUBES GENAXY MTB 17503-10-22 500TUBES per PACK , Collection tube , KIMTECH KIMWIPES 280 per box

CATEGORY: Quagen Multiplex PCR Kit100 Cat.no 206143 , Dimethyl sulfoxide molecular grade Cat.no D8418-50 ML. Sigma , Primer Lis-F 5ATACCATGG TTA CCC CAT TGAGC3 , primer Lis-R 5AGGGCTCATTACATGTGGACCC3 , Primer 4.2-F 5GGTTTACCCATGTGGTGCCTC3 , Primer 4.2-R 5CCCGTTGGATCTTCTCATTTCCC3 , Primer a2-R 5AGACCAGGAAGGGCCGGTG3 , Primer a23.7-F 5CCCCTCGCCAAGTCCACCC3 , Primer 3.720.5-R 5AAAGCACTCTAGGGTCCAGCG3 , Primer 0BG1 5- AACTGTTGCTTTATAGGATTTT-3 , Primer 1BG1 5- AGGAGCTTATTGATAACCTCAGAC-3 , Primer CD26G-AHB E N- TAA CCTTGATACCAACCTGCCCAGGGCGTC , Primer CD26G- AHB E M-TAACCTTGATACCAACCTGCCCAGGGCGTT , ExoSAP Express PCR Product Cleanup cat.no 75001-200ul appliedbiosystems