Type to search...
More Filters
  1. Home/
  2. Indian Tenders/
  3. National Institute Of Pharmaceutical Education And Research/
  4. GEM Tenders/
  5. Archived Tenders
Reset All
National Institute Of Pharmaceutical Education And Research
GEM

Tenders of National Institute Of Pharmaceutical Education And Research in GEM

National Institute Of Pharmaceutical Education And Research - NIPER Tender

Goods
Chemical Products
GEM
Corrigendum : Corrigendum Added
S.a.s Nagar, Punjab
CATEGORY: Chemical 1 , Chemical 2 , Chemical 3 , Chemical 4 , Chemical 5 , Chemical 6 , Chemical 7 , Chemical 8 , Chemical 9 , Chemical 10 , Chemical 11 , Chemical 12 , Chemical 13 , Chemical 14 , Chemical 15 , Chemical 16 , Chemical 17 , Chemical 18 , Chemical 19 , Chemical 20 , Chemical 21 , Chemical 22 , Chemical 23 , Chemical 24 , Chemical 25 , Chemical 26 , Chemical 27 , Chemical 28
Closing Date28 Jan 2025
Tender Amount₹ 1 Lac 
This is an estimated amount, exact amount may vary.

National Institute Of Pharmaceutical Education And Research - NIPER Tender

Goods
GEM
Corrigendum : Corrigendum Added
S.a.s Nagar, Punjab
CATEGORY: Chemical 1 , Chemical 2 , Chemical 3 , Chemical 4 , Chemical 5 , Chemical 6 , Chemical 7 , Chemical 8 , Chemical 9 , Chemical 10 , Chemical 11 , Chemical 12 , Chemical 13 , Chemical 14 , Chemical 15 , Chemical 16 , Chemical 17 , Chemical 18 , Chemical 19 , Chemical 20 , Chemical 21 , Chemical 22 , Chemical 23 , Chemical 24 , Chemical 25 , Chemical 26 , Chemical 27 , Chemical 28 , Chemical 29 , Chemical 30 , Chemical 31 , Chemical 32 , Chemical 33 , Chemical 34 , Chemical 35 , Chemical 36 , Chemical 37 , Chemical 38
Closing Date28 Jan 2025
Tender Amount₹ 84.9 K 
This is an estimated amount, exact amount may vary.

National Institute Of Pharmaceutical Education And Research - NIPER Tender

Goods
Healthcare and Medicine
GEM
S.a.s Nagar, Punjab
CATEGORY: PAMPA Membrane , GIT Activating Phospholipid , Permeapad
Closing Date6 Feb 2025
Tender Amount₹ 2.7 Lac 
This is an estimated amount, exact amount may vary.

National Institute Of Pharmaceutical Education And Research - NIPER Tender

Goods
GEM
Kamrup, Assam
Safety Iron Grills Over Windows
Closing Date15 Feb 2025
Tender AmountRefer Documents 

National Institute Of Pharmaceutical Education And Research - NIPER Tender

Goods
GEM
Kamrup, Assam
Aluminium Partition
Closing Date15 Feb 2025
Tender AmountRefer Documents 

National Institute Of Pharmaceutical Education And Research - NIPER Tender

Goods
GEM
Corrigendum : Corrigendum Added
S.a.s Nagar, Punjab
CATEGORY: Labware 1 , Labware 2 , Labware 3 , Labware 4 , Labware 5 , Labware 6 , Labware 7 , Labware 8 , Labware 9 , Labware 10 , Labware 11 , Labware 12 , Labware 13 , Labware 14 , Labware 15 , Labware 16 , Labware 17 , Labware 18 , Labware 19 , Labware 20 , Labware 21
Closing Date30 Jan 2025
Tender Amount₹ 28.5 K 
This is an estimated amount, exact amount may vary.

National Institute Of Pharmaceutical Education And Research - NIPER Tender

Services
Electrical Works...+1Electrical and Electronics
GEM
Medchal Malkajgiri, Telangana
Annual Maintenance Service-air Conditioner
Closing Date14 Feb 2025
Tender Amount₹ 2 Lac 
This is an estimated amount, exact amount may vary.

National Institute Of Pharmaceutical Education And Research - NIPER Tender

Goods
GEM
S.a.s Nagar, Punjab
CATEGORY: Chemical 1 , Chemical 2 , Chemical 3 , Chemical 4 , Chemical 5 , Chemical 6 , Chemical 7 , Chemical 8 , Chemical 9 , Chemical 10 , Chemical 11 , Chemical 12 , Chemical 13 , Chemical 14 , Chemical 15 , Chemical 16 , Chemical 17 , Chemical 18 , Chemical 19 , Chemical 20 , Chemical 21 , Chemical 22 , Chemical 23 , Chemical 24 , Chemical 25 , Chemical 26 , Chemical 27 , Chemical 28 , Chemical 29 , Chemical 30 , Chemical 31 , Chemical 32 , Chemical 33 , Chemical 34 , Chemical 35
Closing Date15 Feb 2025
Tender Amount₹ 93.6 K 
This is an estimated amount, exact amount may vary.

National Institute Of Pharmaceutical Education And Research - NIPER Tender

Goods
Healthcare and Medicine
GEM
S.a.s Nagar, Punjab
CATEGORY: FAM labelled miRNA let 7b 5p mimic (hsa let 7b 5p) Mature miRNA Sequence UGAGGUAGUAGGUUGUGUGGUU, 100 , miRNA let 7b 5p inhibitor Mature miRNA Sequence UGAGGUAGUAGGUUGUGUGGUU, 100 nm , miRNA let 7b 5p mimic (hsa let 7b 5p) Mature miRNA Sequence UGAGGUAGUAGGUUGUGUGGUU, 100 nm
Closing Date24 Feb 2025
Tender AmountRefer Documents 

National Institute Of Pharmaceutical Education And Research - NIPER Tender

Goods
GEM
S.a.s Nagar, Punjab
CATEGORY: QIAEX II Gel Extraction Kit, 150 reactions
Closing Date31 Jan 2025
Tender Amount₹ 21 K 
This is an estimated amount, exact amount may vary.
311-320 of 371 archived Tenders

eProcurement Tenders in India

eProcurement Tenders are tenders that can be filled and acquired online. Tenderers can visit the official government website - The eProcurement System of India to apply for eProcurement tenders. They enable them to download the 'Tender Schedule' and submit bids online through the portal. Another way to discover the latest tenders would be BidAssist. BidAssist is a one-stop platform for all the businesses to view the eProcurement tenders and their status in one place. We collate tenders from multiple government websites, states websites, and newspapers and bring them all in one place. SMEs can get tender documents using simple pricing plans using our website and mobile app. What makes BidAssist all the more unique for Indian startups is that we offer details into international tenders as well, giving them the opportunity to expand their businesses overseas. The validation of this lies in the fact that 8 lakhs+ SMEs have logged into the official website of BidAssist to search for new business opportunities in India and abroad. Here are some highlights about BidAssist
  • Tenders till date
    • 1.5 crore+
  • App downloads
    • 5 lakh+
  • Active Tenders
    • 3 lakh+
  • Authorities Worldwide
    • 1.9 lakh+
  • Daily tenders searched
    • 25000+

How does BidAssist Work?

eProcurement Tenders are tenders that can be filled and acquired online. Tenderers can visit the official government website - The eProcurement System of India to apply for eProcurement tenders. They enable them to download the 'Tender Schedule' and submit bids online through the portal. Another way to discover the latest tenders would be BidAssist. BidAssist is a one-stop platform for all the businesses to view the eProcurement tenders and their status in one place. We collate tenders from multiple government websites, states websites, and newspapers and bring them all in one place. SMEs can get tender documents using simple pricing plans using our website and mobile app. What makes BidAssist all the more unique for Indian startups is that we offer details into international tenders as well, giving them the opportunity to expand their businesses overseas. The validation of this lies in the fact that 8 lakhs+ SMEs have logged into the official website of BidAssist to search for new business opportunities in India and abroad.
Here are some highlights about BidAssist.
  • Tenders till date
    • 1.5 crore+
  • App downloads
    • 5 lakh+
  • Active Tenders
    • 3 lakh+
  • Authorities Worldwide
    • 1.9 lakh+
  • Daily tenders searched
    • 25000+

FAQs About BidAssist

1. Why should I subscribe to BidAssist?
With BidAssist one can look for any tender by location, summary, authority, and even the tender ID. Like Google you can simply search for tender title, description, tender id and even based on expected BoQ phrases. . By subscribing to a the plan, you can download unlimited documents. So, if in case you plan on downloading more than 3 documents in a month, we recommend you to subscribe to a subscription plan which would allow you to download an unlimited number of documents. Our plans start at Rs 3000/year.
2. How do I search for tenders on BidAssist?
You can search on the website or BidAssist app by entering the name of the tender or tender id or adding in the name of the city, state, keyword, or category. Or you can click on ‘View All Tenders’ to get the same results. In case you are unable to find a tender, simply fill in the details such as - Tender ID, Authority name, etc. and then click on “Report”. You can also drop an email at contact@bidassist.com to report the missing tender.
3. Why should I follow a tender?
Following a tender ensures that you do not miss any changes in the tenders that you want to focus & bid. We send alerts to you if there is any modification, or updates with respect to corrigendum, AOC documents, tender results etc in the tender you have followed. This way, you can remain updated on what is happening with the tender you are interested in.
4. Will I get a refund on the tender document fee if I am not successful?
There is no refund policy. Be rest assured, we are available on chat & toll free numbers to resolve any issue that you may face. While we maintain global standards of customer satisfaction but we ensure that the occasional reported are resolved quickly & swiftly.
TENDER BY COUNTRIES
View All
United States Tenders|
United Kingdom Tenders|
Spain Tenders|
France Tenders|
Qatar Tenders|
Australia Tenders|
Canada Tenders|
China Tenders|
Malaysia Tenders|
Maldives Tenders|
Singapore Tenders|
Bangladesh Tenders|
Ethiopia Tenders|
Bhutan Tenders|
Kuwait Tenders|
Oman Tenders|
Germany Tenders|
Egypt Tenders|
Ghana Tenders|
Saudi Arabia Tenders
TENDER BY AUTHORITIES
View All
Federal Road Agency Tenders|
Bangladesh Railway Tenders|
Area Metropolitana De Barcelona Tenders|
Jsc Russian Railways Tenders|
Kuwait Oil Company Tenders|
Civil Aviation Authority Tenders|
Food And Agriculture Org. Tenders|
Eskom Tenders|
Energy Regulation Commision Tenders|
Dept Of Defence Tenders
TENDER BY CATEGORIES
View All
Agriculture Or Forestry Works Tenders|
Automobiles And Auto Parts Tenders|
Civil And Construction Tenders|
Consultancy Services Tenders|
Education And Training Services Tenders|
Electrical And Electronics Tenders|
Finance And Insurance Sectors Tenders|
Food Products Tenders|
Furnitures And Fixtures Tenders|
Healthcare And Medicine Tenders
TENDER BY PROCUREMENT
Goods Tenders|
Works Tenders|
Services Tenders
OFG MANUFACTURING BUSINESSES PRIVATE LIMITED
  • Head Office
    6th Floor, Global Business Park, Tower A, Besides Guru Dronacharya Metro Station, Gurugram, Haryana - 122002, India
  • Sales Office
    B - 705 & 706, Sankalp Iconic Tower, Opp. Vikramnagar Colony, Iscon Cross Road, S. G. Highway, Ahmedabad - 380054, India
COMPANY
POLICIES
SUPPORT
MOBILE APPS
© Powered by OFG MANUFACTURING BUSINESSES PRIVATE LIMITED, All Rights Reserved