Tenders of Central University Of Himachal Pradesh

CATEGORY: Potassium hydroxide 1000 g , 4 percent Paraformaldehyde 500 ml , Phenol chloroform isoamyl alcohol 300 ml , Sodium carbonate 500 g , Thiobarbituric acid 125 g , Sodium hydroxide 1000 g , Superoxide Dismutase antioxidant assay kit calorimetric 1 , Riboflavin 100 g , Trypan Blue zero point four percent Solution 50 ml , Guaiacol 250 g , Iron chloride FeCl3 100 g , Potassium Ferricyanide 100 g , Iodine 100 g , Dichloromethane 100 ml , Iron sulfate FeSO4 500 g , Sodium Hypochlorite NaOCl 500 ml , Perchloric Acid HClO4 500 ml , Zinc Chloride ZnCl2 500 g , Sodium Iodide NaI 500 g , Phosphate Buffer 500 ml , DNA Extraction Kit for Animal tissue 2 , PCR kit 2 , PBS Phosphate buffered saline 1000 ml , Sodium Chloride 1000 g , Bouins fixative 500 ml , Bradford reagent 1000 ml , ALT Activity kit Calorimetric 50 rxn , AST Activity kit Calorimetric 50 rxn , ALP Activity kit Calorimetric 50 rxn , Giemsa stain 50 ml , Ethanol 15 L , Nitroblue tetrazolium NBT 25 g , S Acetylthiocholine iodide 25 g , Potassium cyanide 500 g , Drabkins reagent 500 ml , Hayemis RBC diluting fluid 100 ml , Turks WBC diluting fluid 100 ml , Heparin anticoagulant 50 ml , Hydrogen peroxide 1500 ml , 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g , Glutathione Reduced GSH 25 g , Two point five percent Glutaraldehyde 500 ml , Diethyl ether AR 1000 ml , Petroleum ether AR grade 2500 ml , Pyrogallol 100 g , Nitric acid 1000 ml , Perchloric acid 1000 ml , Glacial acetic acid 1500 ml , L tryptophan extrapure 100 mg , Barium chloride dehydrate 500 g , Gum acacia 500 g , Magnesium chloride hexahydrate 500 g , Potassium nitrate 500 g , Methyl cellosolve 1000 ml , Citric acid 500 g , Sodium citrate tribasic dehydrate extrapure 98 percent 500 g , Anthrone ACS 98 percent 25 g , N propanol 1000 ml , Ammonium metavanadate 100 g , Phenol crystalline extrapure AR 500 g , Boric acid 500 g , Papain 100 g , Ferric chloride hexahydrate A 100 g , Starch 1000 g , Donepezil hydrochloride 1 , Master mix PCR 100 rxn , DPPH 2 g , ATBS 5 g , CTAB 3 kit , Mcnkey broth 500 g , MHA muller hinton broth 500 g , Sterile disc 2 pack , Plate count agar 500 g , M17 agar 500 g , M17 broth 500 g , Ox bile Ox gall 500 g , MHA agar 500 g , MRS broth 1000 g , MRS agar 1000 g , Pepsin and cysteine 25 g each , X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g , 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g , Columbia agar 500 g , DNA extraction kit for bacteria 1 pack , Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3 , Wurster reagent N N N N tetramethyl pphenylenediamine 10 g , Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , D Arabinose 100 g , D Reffinose 100 g , Gram staining kit 200 ml reagents , Trypsin 10 g , Nutrient Agar 500 g , Nutrient Broth 500 g

BOQ Title: Substrate and other consumable items

CATEGORY: D5652-10X1L , eppenndorf-microcentrifuge tubes 1.5Ltr , Ethanol 99 percent , Ethylenediaminetetraacetic acid disodium salt dihydrate , centrifuge tubes 15ml , Folin and Ciocalteu phenol reagent , Formaldehyde CAS No 50-00-0 252549-100ml , Formic acid GR 98.0-100 percent cas no 64- 18-6 , Furan for Synthesis Assay 99 percent CAS 110-00-9 1 Pack of 100ml , Furfuraldehyde AR ACS Assay 99percent CAS 98-01-1 1 Pack of 500 , Gallic acid 149-91-7 , Glycerol 56-81-5 , Graphite fine powder 98percent CAS 16940-66-2 , High salt medium , Hydrogen peroxide solution 30percent CAS 7722-84-1 , ICP multi-element standard solution IV Sigma Merck 23 elements in diluted nitric acid 1000 mg l Ag, Al, B, Ba, Bi, Ca, Cd, Co, Cr, Cu, Fe, Ga, In, K, Li, Mg, Mn, Na, Ni, Pb, Sr, Tl, Zn , Immersion oil , In line syringe filter holder 25mm PSF Tarson or polylab or Axiva , In line syringe filter holder 47mm PSF Tarson or polylab or Axiva , iron oxide CAS No 1309-37-1 , L-Malic acid 99percent CAS 97- 67-6 , LB Broth , MacConkey agar , Mask , Methyl diethanol amine CAS 105-59-9 , Methyl orange CAS 547-58-0 3x100gm , Methyl red CAS 493-52-7 3x100gm , Methyl yellow CAS 60-11-7 3x100gm , Mini spatula , N-Methyl-2- pyrrolidone for HPLC 99percent , NaOH-solid CAS No 1310732 6x1kg , Neutral red AR CAS 553-24-2 , Nutrient agar , Nutrient broth , p-Nitrophenol AR CAS 100-02-7 , ParaFromaldehyde CAS 30525-89-4 , Petroleum ether CAS No 8032324 , Phenol red sodium salt indicator CAS 34487- 61-1 , Phenolphthalein Indicator CAS 77-09-8 5 x100gm , Phenyl Boronic Acid CAS 98-80-6 1Pack of 25g , Pipette Rack Horizontal Z shape polypropylene Tarson or polylab orAxiva , PNPA-paranitrophenylacetate 2 Bottle of 25g , Polyvinylidene fluoride CAS 24937-79-9 , Polypropylene beaker garduated 500mlTarson or polylab or Axiva , Polypropylene forcep , Polypropylene measuring cylinder graduated Class A 500ml Tarson or polylab , Potassium Hydroxide 90 percent flakes 484016-1kg , Potassium permanganate 238511-100gm , Potassium persulphate 7727-21-1 , Potassium sulphate CAS No 7778805 223492- 500gm , Potato dextrose agar , Potato dextrose broth , PTFE Stirrer 10 x 250mm , Pyrrole for Synthesis Assay 97.5percent CAS 109-97-7 1 Pack of 100ml , Quinoline for Synthesis 1 Pack of 500ml , Rosolic acid CAS 603-45-2 , Sabaourd dextrose agar , Safety face shield Tarson or polylab or Axiva , Scintillation vial polypropylene 20ml Tarson or polylab or Axiva , Silicon Oil for Oil Baths upto 250 Degree Celsius 1Pack of 2.5l , Silicon oil for oil baths upto 250 oC CAS 63148-62-9 , Sodium Azide less than 99.5 percent CAS 26628-22-8 , Sodium borohydride 98.5percent CAS 16940-66-2 , Sodium Chlorate 1Pack of 100g , River sedimentbioavailable phosphorous standard BCR684-35G , Sodium sulphate anhydrous CAS No 7757826 238597- 500gm , Stainless steel Scoop 500gm capacity , stearic acid CAS No 57-11-4 , Succinic acid 99percent CAS 110-15-6 , Sulphur CAS No 7704349 13825-1kg-R , sulphuric acid 98percent , TLC Plates Aluminium Oxide Coated with fluorescent Indicator F254 1 Pack of 20 Units , Tray , Tris acetate phosphate CAS No 77861 252859-500gm , Universal pH indicator , Utility tray Polypylene 320x 260x70 Tarson or polylab or Axiva , Utility tray Polypylene 540x 435x 130 Tarson or polylab or Axiva , Yeast extract peptone dextrose 79883-500G Y1500 , Zinc oxide CAS No 1314-13-2 , Zinc sulphate 7446-19-7 , Hydrochloric acid 12 N CAS Number7647-01-0