Tender Results of Sikkim University

Tender Results of Sikkim University

Sikkim University Tender Result

Goods
GEM
Result Stage: Awarded  (AOC Available)
East Sikkim, Sikkim
Contract Date6 Feb 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 5.2 Lac 
CATEGORY: 2 2 Bipyridine , 4-mercaptobenzoic acid , Acetone , Adenine , Amine functionalized graphene , Carbon Tetra Chloride , Ethanol 99 percent , Ethylene Glycol , Fullerene C 60 98 percent , Graphene , Graphene nanoribbon , Isopropyl alcohol , Lead II Chloride , Lead II nitrate , Mercury II Chloride , Mercury II nitrate monohydrate , Methanol , m xylene anhydrous , N N Dimethylformamide anhydrous 99 percent , PEDOT PSS , Phenylhydrazine , Rodamine 6G , Silver Nitrate , Sodium borohydride , sodium dodecyl sulfate , Thiophenol , Titanium III chloride solution , Titanium nitride , Toluene , Aluminium Foil , Batteries 9 V , Batteries AA , Batteries AAA , BOROSILICATE GLASS VACUUM BUCHNER FILTER FUNNEL WITH CONE. G3 , Clipper and Clampers Trainer NV6511 , Extension Strip , Hair Dryer , Hand gloves , Laboratory Cleaning Towel , Multimeter , Napkin paper , Parafilm , Pen Drive , Round Bottom Flask with interchangeable joint made of 3.3 borosilicate glass For Rota Vac , Table Duster , Teflon tape White , Tissue paper roll , Torch Lights , Wien Bridge

Sikkim University Tender Result

Goods
GEM
Result Stage: Under Evaluation
East Sikkim, Sikkim
Contract Date6 Feb 2024
This is an estimated contract date, exact date may vary.
Contract AmountRefer Documents 
CATEGORY: Tributyl1-ethoxyvinyl tin , 35 Dibromobenzaldehyde , 5 Methyl 1 10 phenanthroline , Potassium tertiary butoxide , NBS , Trifluoromethane Sulfonic Acid , Potassium tetrachloroaurate iii , Palladium Acetate , 2 Aminopyridine , 1 10 Phenanthroline , Ethanol amine , Cisteamine Hydrochloride , 2Methacrylic Acid , 2Aminothiophenol , Tetra butyl ammonium perchlorate , N phenylglycine , Methylbromide , Dibromomethane , 2 bromoacetylbromide , 2Bromobenzoic acid , 2Bromo 3 nitrobenzoic acid , 2 Iodobenzoic acid , N N Dimethylaniline , E Buta 13 dien 1ylbenzene , E 3 4 Chlorophenyl acrylaldehyde , E 3 4 Methoxyphenyl acrylaldehyde , Isopropyl Alcohol HPLC grade , N Hexane HPLCgrade 99percentage , Paraformaldehyde , Ethyl bromoacetate , DRY Toluene , N pentane , Cesium Carbonate , Chloroform D , Cinnamaldehyde 3 Phenylacrylaldehyde , 1Bromo 3 fluoro-5 nitrobenzene , 3 Phenylpropanoic acid , 2 3 Benzofuran , Methyl acetate , Triglyme , L Glutathione 98percent , methyl 4 iodobenzoate , methyl 1H- indole 6 carboxylate , 5 4 Carboxyphenyl 1 1 3 1 terphenyl 44 dicarboxylic acid 95percentage , 1Methylimidazole 98percentage , 334Dihydroxyphenyl acrylic acid 98 percentage , Polyvinylpyrrolidone k 30 , L Epicatechin , 5 4 Carboxyphenyl 2 methyl 11 3 1 terphenyl 4 4 dicarboxylic acid 98 percentage , 4 5 Bis 3 carboxyphenyl 1 1 2 1 terphenyl 3 3 dicarboxylic acid 98 percentage , 5 3 5 Dicarboxyphenyl-1 1 3 1 terphenyl 3 3 5 5 tetracarboxylic acid 98 percentage , L Adrenaline , Methyl indole 3carboxylate 98 percentage , Iron II chloride tetrahydrate , 4 Dimethylaminopyridine , 55 Dimethyl 1 pyrroline N oxide, 97 percentage , 3355 Tetramethyl 11 biphenyl 4 4 diamine 98 percentage , 5 5 Dimethyl 2 2 bipyridine 98 percentage , 2 4 Dichlorophenol, 98 percentage , Glucose Oxidase Aspergillus Niger , 1h Pyrazole 4 carboxylic acid 98 , 2 Nitroimidazole, 99 percentage , Iodomethane, 98 percentage , 3 3 4 Dihydroxyphenylacrylic acid 98 percentage , 4 Iodobenzoic acid 97 percentage , Copper I acetate 97 percentage , 6 6 Dimethyl 2 2 bipyridine 98 percentage , 4 4 Dimethyl 2 2 bipyridine 98 percentage , N Pentane 99 percentage , 1 10 Phenanthroline 98 percentage , Hydrogen peroxide 30 percentage , Tert Butyl hydroperoxide, 70 percentage aqueous solution , 4 tert Butylcatechol 98 percentage , Acetonitrile HPLC Grade , 2 Amino 4 6 dimethylpyrimidine , Nicotinic Acid hydrazide , 3 Hydroxy 2 naphthoic Acid Hydrazide , 8 Hydroxyjulolidine 9 carboxaldehyde , Diaminomaleonitrile , 2 hydroxy 3 methoxybenzaldehyde , 1 2 4 Triazole 3 5 diamine , Pyrazinoic acid hydrazide , 3 5 di tert butyl 2 hydroxybenzaldehyde , 2 Hydroxy 1 naphthaldehyde , 3 amino 1 2 4 triazole , 3 Amino 5 methylthio-1H-1 2 4 triazole , 2 2 Dimethyl 1 3 propanediamine , Terephthalaldehyde , 4 aminoazobenzene , 2 Hydrazinyl 4 6 dimethylpyrimidine , Cyclopropanecarbohydrazide , Pivalohydrazide , 2 Thiophenecarboxylic acid hydrazide , 2 Furoic hydrazide , 2 6 Diacetylpyridine , 2 Acetylpyridine , Quinoline 2 carboxaldehyde

Sikkim University Tender Result

Services
Software and IT Solutions
GEM
Result Stage: Awarded  (AOC Available)
East Sikkim, Sikkim
Contract Date31 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 26.8 Lac 
CATEGORY: Annual Maintenance Service - Desktops, Laptops and Peripherals - Desktop PC; Mixed , Annual Maintenance Service - Desktops, Laptops and Peripherals - Laptop; Mixed , Annual Maintenance Service - Desktops, Laptops and Peripherals - Work station; Mixed , Annual Maintenance Service - Desktops, Laptops and Peripherals - Server Computer; Mixed

Sikkim University Tender Result

Goods
GEM
Result Stage: Awarded  (AOC Available)
East Sikkim, Sikkim
Contract Date30 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 2.4 Lac 
CATEGORY: DEPC Diethyl pyrocarbonate , Rnasezap , PCR master mix Green , Rneasy plant mini Mini Kit 50 , 10x Dnase I reaction buffer , Quantabio qScript cDNA supermix , Quantitech SYBR Green PCR kit 200 , StepUp 250bp DNA Ladder 100 loads 50 microgm , RNA later , DNase I Rnase free , Diluent for DNA Extraction , Jasmonic acid , Formic Acid , nylon syringe filters Polyethersulfone PES Syringe Filters 02 Micron 25mm , Cryo tags , Nitrile gloves , RT PCR plates 96 wells , Microseal Bseal Seals , Autoclavable bags 12 by 24 , Autoclavable bags 14by 19

Sikkim University Tender Result

Goods
Electrical and Electronics...+2Electronics Equipment, Software and IT Solutions
GEM
Result Stage: Awarded  (AOC Available)
East Sikkim, Sikkim
Contract Date30 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 16.6 Lac 
CATEGORY: Rack Server , 8-Port Rack Mount KVM Console , Wireless Keyboard and Mouse , 4 TB External SSD Drive , Network Switch , PDU and Server Room cable labelling and arrangement , Thermal Printer , Overhead Scanner

Sikkim University Tender Result

Goods
Furnitures and Fixtures
GEM
Result Stage: Awarded  (AOC Available)
South Sikkim, Sikkim
Contract Date18 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 4.9 Lac 
CATEGORY: Examination table with cabinets , Semifowler hospital bed with mattress , Hospital basic bedside table , Hospital adjustable height table , Patient revolving stool , Footsteps , Drip stand , Dressing trolley with bowl and bin , Examination Surgical light , ECG Machine - 12 Lead , X - ray view box , Electric Sterilizer , Stadiometer , First Aid Box , Weighing Machine , Patient Monitor

Sikkim University Tender Result

Goods
Chemical Products
GEM
Result Stage: Awarded  (AOC Available)
East Sikkim, Sikkim
Contract Date17 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 4.1 Lac 
CATEGORY: 3 5 Dinitrosalicylic Acid , 6 Benzyl Adenine BAP , Absisic Acid , Acetic Acid Glacial , Adenine Sulphate Dihydrate , Aluminium Standard , Ammonium Dihydrogen Phosphate GR , Ammonium Ferrous Sulphate , Ammonium Monohydrate , Ammonium Persulfate , Ammonium Phosphate Monobasic , Ammonium Sulphate GR , Ammonium thiocyanate , Amylum , Anthrone reagent , Antimony Trichloride , Arsenic Standard , Boric Acid GR Pure , Boron Standard , Bovine Serum Albumin , Bromocresol Green Indicator , Bromophenol Blue , Bromothymol Blue Solution , Butylated Hydroxytoluene , Cadmium Standard , Caffeic acid , Calcium Standard , Carbon Tetrachloride , Cobalt II Chloride heptahydrate , Cobalt Standard , Copper chloride , Cresol Red , Curcumin , Cysteine L Cysteine , D plus Glucose Dextrose monohydrate AR , Disodium Hydrogen Phosphate , Disodium Hydrogen Phosphate Dihydrate , DTPA Diethylenetriamine Penta Acetic Acid , Dinitrosalicylic acid , Diphenylamine AR , Dragendorffs Reagent , EDTA Ferric monosodium Salt , EDTA Disodium salt Dihydrate MB Grade , Ferric Citrate monohydrate , Folic acid , Gallic acid monohydrate , Green Master Mix , Hydrochloric Acid HCl , Indol 3 Butyric Acid , Indole 3 Acetic Acid , Iron II Chloride Tetrahydrate Ferrous Chloride , Iron III Chloride Ferric Chloride , Lead Standard Solution , Magnesium Standard , Methanol hplc grade , Molybdenum Standard , Naphthalene Acetic Acid , Nitroblue tetrazolium chloride , Nitrophenol AR Spectrophotometric grade p nitrophenol , Phenolphthalein Indicator , Potassium Phosphate Monobasic Potassium H2 Orthophosphate , DNA LADDER 1kb , DNA LADDER 100bp , Sodium Hydroxide NaOH , Sodium Hypochlorite Soln , Sodium Phosphate Monobasic Monohydrate , Sodium Phosphate Dibasic Heptahydrate , Sodium Standard , Tetrazolium salt , ICP Multi standard Solution , mordant alum , Teepol , copper sulphate , 2 6 Dicholrophenol , indophenol , potassium thiocynate , ammonium metavanadate , beta carotene , Potassium sodium tartarate , oxalic acid , potassium permanganate , zinc sulphate , citric acid anhydrous , acetone , Acetone molecular grade , sodium carbonate , phenol crystal , Phenopthalin indicator , Plant preservative mixture tissue culture , 2napthoxyacetic acid , picloram , Polyvinylpyrrolidone PVP k30 , benzyl adenine BA , MS Medium 100x1Ltr with cacl2 and vitamins sucrose and agar , thiadiazuron TDZ , 2 4 D plant tissue culture tested , 4 methyl catechol , Ethidium bromide , Nuclease free water , Evans Blue , Trifluroacetic acid TFA HPLC grade , DEAE cellulose HPLC grade , HPLC grade water , sodium phytate , sodium acetate trihydrate , p Nitrophenol , Tris buffer , sodium b glycerolphosphate , Acetonitrile HPLC grade , Ethyl acetate HPLC grade , 0 point2 micrometer membrane filter1 for HPLC , Nylon filter membranes 0 point45 micrometer , Buffer Tablets pH 4 , Buffer Tablets pH 7 , Buffer tablets pH 9 , dendrobin , Safranine , 6X Gel loading buffer , Ammonium Hydrogen phosphate

Sikkim University Tender Result

Goods
GEM
Result Stage: Awarded  (AOC Available)
East Sikkim, Sikkim
Contract Date17 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 1.4 Lac 
Forward Acgagctaaagctcattagggtaa Reversetcggcaagaatacaaagtgagtaa,forward Ggatcgttcctttttagggtaat Re

Sikkim University Tender Result

Goods
GEM
Result Stage: Awarded  (AOC Available)
East Sikkim, Sikkim
Contract Date17 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 3.2 Lac 
CATEGORY: Beaker Glass , Conical Flask Narrow mouth , Culture tubes flat bottom screw cap , Culture Tubes flat bottom screw cap , culture tubes flat bottom screw cap , Measuring Cylinder Glass , Micropippette , Micropippetes , Microtip zero point 2 to 10 microlitre , Microtip 2 to 200 microlitre , Microtip 200 to1000 microlitre , Microtip Box zero point 2 to10 microlitre , Microtip Box 2 to 200 micro litre , Microtip Box 200 to 1000 micro litre , PCR tubes zero point 2ml flat cap , Microcentrifuge tube 1point5ml , Microcentrifuge tube 2ml , cryo vial 100 places , PCR Rack , MicroPippete rack Z type , Test Tube , Test tube , Centrifuge tube conical bottom , Float rack Cryo vial , PCR workstation , HPLC vials amber clear , Microscope slide box , pellet pestles micro pestles , Eppendorf tube rack , pycnometer , Glass rod , instrument sterilizing pan autoclavable , Biohazard waste container , zero degree mini cooler PC with non toxic gel , Gloves nitrile gloves Long cuff Tarson , nitrile gloves Tarson , surgical mask , Magnetic Retriever , Polygon Magnetic Stirrer Bar , Parrafilm M 5cm , motar and pestle , Aluminium Foil , Tissue Paper , Vetroclean , Colour charts for plants , tough tags with station , Autoclavable bag bio hazard

Sikkim University Tender Result

Goods
GEM
Result Stage: Awarded  (AOC Available)
East Sikkim, Sikkim
Contract Date17 Jan 2024
This is an estimated contract date, exact date may vary.
Contract Amount₹ 1.9 Lac 
CATEGORY: Blotting paper , seive 2mm with frame , Plastic pots nursery pots , Plastic pots , Vermicompost , Green House Uv stablized plastic , muslin cloth , Nursery bags black with holes medium , thermo hygrometer digital RH temperature , Tensiometer , ordinary Rain gauge , Laboratory Apron heavy duty , Foldable telescopic aluminium ladder , nylon brush small , nylon brush large , safety goggles , spray bottle , Anti hail net , Bavistine , Plant label holder T type witn tilted head , Maximum minimum thermometer
61-70 of 135 active Tender Results