Tenders of Indian Council Of Medical Research in Mumbai

... More
Explore the latest Indian Council Of Medical Research tenders in Mumbai published through Indian Council Of Medical Research eProcurement portal. These tenders create lucrative opportunities for businesses, contractors, and suppliers in Mumbai to secure profitable contracts. If you're looking for Indian Council Of Medical Research tenders in Mumbai, you can find the latest listings, eligibility criteria, and submission details on the Indian Council Of Medical Research eTender portal. The portal provides a seamless and transparent way to participate in Indian Council Of Medical Research tenders. Additionally, platforms like BidAssist provide real-time updates, and make it easier to track and apply for relevant Indian Council Of Medical Research tenders in Mumbai.
Sorry!
No Active
Tenders of Indian Council Of Medical Research in Mumbai
found
Check archived
Tenders of Indian Council Of Medical Research in Mumbai

Indian Council Of Medical Research - ICMR Tender

Goods
GEM
Mumbai, Maharashtra
Closing Date28 Nov 2023
Tender Amount₹ 5.6 Lac 
This is an estimated amount, exact amount may vary.
CATEGORY: gDNA QC genome wide methylation analysis of human samples using Infinium Methylation EPIC Bead Chip v2.0 with IIIumina iScan With final Bioinformatic Analysis report A , gDNA QC genome wide methylation analysis of human samples using Infinium Methylation EPIC Bead Chip v2.0 with IIIumina iScan With final Bioinformatic Analysis report B , gDNA QC genome wide methylation analysis of human samples using Infinium Methylation EPIC Bead Chip v2.0 with IIIumina iScan With final Bioinformatic Analysis report C , gDNA QC genome wide methylation analysis of human samples using Infinium Methylation EPIC Bead Chip v2.0 with IIIumina iScan With final Bioinformatic Analysis report D , gDNA QC genome wide methylation analysis of human samples using Infinium Methylation EPIC Bead Chip v2.0 with IIIumina iScan With final Bioinformatic Analysis report E , gDNA QC genome wide methylation analysis of human samples using Infinium Methylation EPIC Bead Chip v2.0 with IIIumina iScan With final Bioinformatic Analysis report F , gDNA QC genome wide methylation analysis of human samples using Infinium Methylation EPIC Bead Chip v2.0 with IIIumina iScan With final Bioinformatic Analysis report G , gDNA QC genome wide methylation analysis of human samples using Infinium Methylation EPIC Bead Chip v2.0 with IIIumina iScan With final Bioinformatic Analysis report H

Indian Council Of Medical Research - ICMR Tender

Goods
GEM
Corrigendum : Closing Date Modified
Mumbai, Maharashtra
Closing Date12 Dec 2023
Tender Amount₹ 2.6 Lac 
This is an estimated amount, exact amount may vary.
CATEGORY: 30000838 , 30000897 , 30000927 , 3123000055 , 2231300004

Indian Council Of Medical Research - ICMR Tender

Services
Transportation and Logistics
GEM
Mumbai, Maharashtra
Closing Date18 Nov 2023
Tender Amount₹ 6.5 Lac 
CATEGORY: Courier Service in KG - National; Within State

Indian Council Of Medical Research - ICMR Tender

Goods
GEM
Mumbai, Maharashtra
Closing Date24 Nov 2023
Tender Amount₹ 39.2 K 
This is an estimated amount, exact amount may vary.
CATEGORY: Goat anti-Mouse IgG H PLUS L Secondary Antibody unconjugated , Goat anti-Mouse IgG H PLUS L Secondary Antibody HRP , PowerTracka c SYBR Green Master Mix for qPCR , Primers SIRT3 Forward 5aE CGGCTCTACACGCAGAACATC3aE SIRT3 Reverse 5aE CAGAGGCTCCCCAAAGAACAC3aE , Primers PGC-1 Forward 5aE TCAGTCCTCACTGGTGGACA3aE PGC-1 Reverse 5aE TGCTTCGTCGTCAAAAACAG3aE

Indian Council Of Medical Research - ICMR Tender

Goods
GEM
Mumbai, Maharashtra
Closing Date27 Nov 2023
Tender Amount₹ 3.2 Lac 
CATEGORY: 323219 , 344023 , 328107 , 327408 , 307629 , 205509 , 203007 , 192455 , 5741S , 3699S , SC-376436 , R044A , RR310A