Tenders of Indian Council Of Medical Research in Mumbai
... More
Explore the latest Indian Council Of Medical Research tenders in Mumbai published through Indian Council Of Medical Research eProcurement portal. These tenders create lucrative opportunities for businesses, contractors, and suppliers in Mumbai to secure profitable contracts.
If you're looking for Indian Council Of Medical Research tenders in Mumbai, you can find the latest listings, eligibility criteria, and submission details on the Indian Council Of Medical Research eTender portal. The portal provides a seamless and transparent way to participate in Indian Council Of Medical Research tenders. Additionally, platforms like BidAssist provide real-time updates, and make it easier to track and apply for relevant Indian Council Of Medical Research tenders in Mumbai.
Sorry!
No Active
Tenders of Indian Council Of Medical Research in Mumbai
foundCheck archived
Tenders of Indian Council Of Medical Research in Mumbai
Indian Council Of Medical Research - ICMR Tender
GEM
Mumbai, Maharashtra
Closing Date28 Nov 2023
Tender Amount₹ 5.6 Lac This is an estimated amount, exact amount may vary.
CATEGORY: gDNA QC genome wide methylation analysis of human
samples using Infinium Methylation EPIC Bead Chip v2.0
with IIIumina iScan With final Bioinformatic Analysis report A
, gDNA QC genome wide methylation analysis of human
samples using Infinium Methylation EPIC Bead Chip v2.0
with IIIumina iScan With final Bioinformatic Analysis report B
, gDNA QC genome wide methylation analysis of human
samples using Infinium Methylation EPIC Bead Chip v2.0
with IIIumina iScan With final Bioinformatic Analysis report C
, gDNA QC genome wide methylation analysis of human
samples using Infinium Methylation EPIC Bead Chip v2.0
with IIIumina iScan With final Bioinformatic Analysis report D
, gDNA QC genome wide methylation analysis of human
samples using Infinium Methylation EPIC Bead Chip v2.0
with IIIumina iScan With final Bioinformatic Analysis report E
, gDNA QC genome wide methylation analysis of human
samples using Infinium Methylation EPIC Bead Chip v2.0
with IIIumina iScan With final Bioinformatic Analysis report F
, gDNA QC genome wide methylation analysis of human
samples using Infinium Methylation EPIC Bead Chip v2.0
with IIIumina iScan With final Bioinformatic Analysis report G
, gDNA QC genome wide methylation analysis of human
samples using Infinium Methylation EPIC Bead Chip v2.0
with IIIumina iScan With final Bioinformatic Analysis report H
Indian Council Of Medical Research - ICMR Tender
GEM
Mumbai, Maharashtra
Closing Date12 Dec 2023
Tender Amount₹ 2.6 Lac This is an estimated amount, exact amount may vary.
CATEGORY: 30000838 , 30000897 , 30000927 , 3123000055 ,
2231300004
Indian Council Of Medical Research - ICMR Tender
Transportation and Logistics
GEM
Mumbai, Maharashtra
Closing Date18 Nov 2023
Tender Amount₹ 6.5 Lac
CATEGORY: Courier Service in KG - National; Within State
Indian Council Of Medical Research - ICMR Tender
GEM
Mumbai, Maharashtra
Closing Date24 Nov 2023
Tender Amount₹ 39.2 K This is an estimated amount, exact amount may vary.
CATEGORY: Goat anti-Mouse IgG H PLUS L Secondary Antibody
unconjugated , Goat anti-Mouse IgG H PLUS L Secondary
Antibody HRP , PowerTracka c SYBR Green Master Mix for
qPCR , Primers SIRT3 Forward 5aE
CGGCTCTACACGCAGAACATC3aE SIRT3 Reverse 5aE
CAGAGGCTCCCCAAAGAACAC3aE , Primers PGC-1 Forward
5aE TCAGTCCTCACTGGTGGACA3aE PGC-1 Reverse 5aE
TGCTTCGTCGTCAAAAACAG3aE
Indian Council Of Medical Research - ICMR Tender
GEM
Mumbai, Maharashtra
Closing Date27 Nov 2023
Tender Amount₹ 3.2 Lac
CATEGORY: 323219 , 344023 , 328107 , 327408 , 307629 , 205509 ,
203007 , 192455 , 5741S , 3699S , SC-376436 , R044A ,
RR310A